Incidental Mutation 'R6898:Gnl3'
ID538468
Institutional Source Beutler Lab
Gene Symbol Gnl3
Ensembl Gene ENSMUSG00000042354
Gene Nameguanine nucleotide binding protein-like 3 (nucleolar)
Synonymsnucleostemin, NS
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6898 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location31012433-31019152 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 31013179 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 485 (S485R)
Ref Sequence ENSEMBL: ENSMUSP00000047119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022476] [ENSMUST00000037739] [ENSMUST00000168584] [ENSMUST00000226378] [ENSMUST00000226740] [ENSMUST00000227467] [ENSMUST00000228341]
Predicted Effect probably benign
Transcript: ENSMUST00000022476
SMART Domains Protein: ENSMUSP00000022476
Gene: ENSMUSG00000021916

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Glyco_transf_8 67 340 1.7e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037739
AA Change: S485R

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000047119
Gene: ENSMUSG00000042354
AA Change: S485R

DomainStartEndE-ValueType
Pfam:GN3L_Grn1 16 90 4.3e-25 PFAM
low complexity region 112 126 N/A INTRINSIC
SCOP:d1egaa1 130 207 3e-3 SMART
low complexity region 209 220 N/A INTRINSIC
Pfam:MMR_HSR1 251 362 2.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168584
SMART Domains Protein: ENSMUSP00000129323
Gene: ENSMUSG00000021916

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Glyco_transf_8 67 340 8.6e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226378
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000226740
Predicted Effect probably benign
Transcript: ENSMUST00000227467
Predicted Effect probably benign
Transcript: ENSMUST00000228341
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may interact with p53 and may be involved in tumorigenesis. The encoded protein also appears to be important for stem cell proliferation. This protein is found in both the nucleus and nucleolus. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous disruption of this gene leads to early embryonic loss as blastocysts fail to enter the S phase. MEFs heterozygous for a gene trap allele have reduced proliferative capacity while MEFs heterozygous for a null allele show reduced doubling rates,increased apoptosis and premature senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,931,041 Y325F probably damaging Het
4430402I18Rik T G 19: 28,944,288 Q146P probably benign Het
Ankrd7 G T 6: 18,868,101 probably null Het
Aplnr A T 2: 85,139,811 probably benign Het
Capns2 T C 8: 92,901,977 S165P probably damaging Het
Col25a1 T C 3: 130,584,728 probably null Het
Crocc2 T C 1: 93,215,582 V1302A probably benign Het
Cul9 C A 17: 46,511,026 R1841M possibly damaging Het
Dnhd1 T C 7: 105,687,377 L1213P probably damaging Het
Dscam A T 16: 96,829,900 I305K probably benign Het
Dsp A G 13: 38,192,217 E1326G possibly damaging Het
Emc9 A G 14: 55,584,910 probably null Het
Eppk1 A C 15: 76,111,926 S252A probably benign Het
Fn1 T A 1: 71,600,413 T1830S probably damaging Het
Fryl A T 5: 73,022,142 M2974K probably damaging Het
Gdpd3 C A 7: 126,771,029 S250* probably null Het
Gm13088 A T 4: 143,655,483 N214K probably damaging Het
Gm8994 T A 6: 136,328,619 V26E probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Hsd17b3 T C 13: 64,059,525 Y234C probably benign Het
Lima1 T C 15: 99,781,267 H271R possibly damaging Het
Nfu1 G A 6: 87,017,052 probably null Het
Noto A G 6: 85,427,960 E97G probably damaging Het
Ntng1 T C 3: 109,872,218 K348E probably damaging Het
Olfr1242 C T 2: 89,494,250 G21R possibly damaging Het
Olfr1383 G A 11: 49,523,709 probably benign Het
Osmr C A 15: 6,815,883 V801F probably damaging Het
Papln A G 12: 83,777,460 E554G probably benign Het
Pitrm1 T C 13: 6,555,459 L175P probably damaging Het
Pramel7 T C 2: 87,489,726 T408A probably damaging Het
Serinc2 A T 4: 130,255,442 D322E probably benign Het
Setx T C 2: 29,148,108 V1535A probably benign Het
Sgce A T 6: 4,689,666 V389E probably damaging Het
Snx11 G A 11: 96,769,062 T267I probably benign Het
Specc1 G A 11: 62,118,336 S306N probably benign Het
Spocd1 A G 4: 129,956,512 probably benign Het
St7 T A 6: 17,854,946 V294D probably damaging Het
Stab1 C T 14: 31,158,963 R624Q probably benign Het
Tcf21 T C 10: 22,819,504 I134V probably benign Het
Tgfb2 T A 1: 186,632,500 I266F probably damaging Het
Tgfbr3l A G 8: 4,250,365 I209M possibly damaging Het
Tmcc3 A G 10: 94,551,172 probably null Het
Toe1 A G 4: 116,807,474 S16P probably damaging Het
Vps16 T C 2: 130,437,681 V38A possibly damaging Het
Wnk2 G T 13: 49,071,081 D1001E probably damaging Het
Other mutations in Gnl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Gnl3 APN 14 31014189 missense possibly damaging 0.71
IGL00826:Gnl3 APN 14 31012796 unclassified probably benign
IGL02323:Gnl3 APN 14 31017402 missense probably damaging 1.00
R0277:Gnl3 UTSW 14 31013427 critical splice donor site probably null
R0636:Gnl3 UTSW 14 31017153 missense probably damaging 1.00
R0727:Gnl3 UTSW 14 31017077 missense probably damaging 0.99
R1459:Gnl3 UTSW 14 31017846 missense probably damaging 1.00
R1474:Gnl3 UTSW 14 31016461 splice site probably benign
R2016:Gnl3 UTSW 14 31016369 unclassified probably null
R2352:Gnl3 UTSW 14 31016826 critical splice donor site probably null
R2517:Gnl3 UTSW 14 31014163 missense probably damaging 1.00
R4115:Gnl3 UTSW 14 31016856 missense probably damaging 1.00
R4697:Gnl3 UTSW 14 31017329 missense probably damaging 0.98
R4853:Gnl3 UTSW 14 31015313 missense probably damaging 0.99
R4973:Gnl3 UTSW 14 31013505 missense possibly damaging 0.68
R5091:Gnl3 UTSW 14 31016846 missense possibly damaging 0.76
R5580:Gnl3 UTSW 14 31015285 missense probably benign
R5914:Gnl3 UTSW 14 31016896 missense possibly damaging 0.85
R7292:Gnl3 UTSW 14 31013232 missense probably benign
R7372:Gnl3 UTSW 14 31016886 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TTGGTGGCACCCCTAACTAAG -3'
(R):5'- GCTAGAGGTCTTATCTGTTAACCTGAG -3'

Sequencing Primer
(F):5'- TCTACAGAGTGAGTTCCAGGAC -3'
(R):5'- AGTTTATTTCCTCTAGTCCTCAAGGG -3'
Posted On2018-11-06