Incidental Mutation 'R6898:Osmr'
ID 538471
Institutional Source Beutler Lab
Gene Symbol Osmr
Ensembl Gene ENSMUSG00000022146
Gene Name oncostatin M receptor
Synonyms OSMRB
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock # R6898 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 6813577-6874969 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 6815883 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 801 (V801F)
Ref Sequence ENSEMBL: ENSMUSP00000135204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022746] [ENSMUST00000176826]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000022746
AA Change: V802F

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000022746
Gene: ENSMUSG00000022146
AA Change: V802F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 26 35 N/A INTRINSIC
Blast:FN3 234 317 9e-38 BLAST
FN3 330 412 6.25e-3 SMART
FN3 427 512 2.75e0 SMART
FN3 523 607 7.02e1 SMART
FN3 619 720 3.17e-4 SMART
transmembrane domain 736 758 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176826
AA Change: V801F

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135204
Gene: ENSMUSG00000022146
AA Change: V801F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 26 35 N/A INTRINSIC
Blast:FN3 234 317 9e-38 BLAST
FN3 330 412 6.25e-3 SMART
FN3 427 512 2.75e0 SMART
FN3 523 606 2.77e1 SMART
FN3 618 719 3.17e-4 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 775 786 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I cytokine receptor family. The encoded protein heterodimerizes with interleukin 6 signal transducer to form the type II oncostatin M receptor and with interleukin 31 receptor A to form the interleukin 31 receptor, and thus transduces oncostatin M and interleukin 31 induced signaling events. Mutations in this gene have been associated with familial primary localized cutaneous amyloidosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit anemia, decreased hematocrit, and reduced erythroid progenitor, erythrocyte, platelet, and megakaryocyte cells. Homozygotes also show increased susceptibility to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,931,041 Y325F probably damaging Het
4430402I18Rik T G 19: 28,944,288 Q146P probably benign Het
Ankrd7 G T 6: 18,868,101 probably null Het
Aplnr A T 2: 85,139,811 probably benign Het
Capns2 T C 8: 92,901,977 S165P probably damaging Het
Col25a1 T C 3: 130,584,728 probably null Het
Crocc2 T C 1: 93,215,582 V1302A probably benign Het
Cul9 C A 17: 46,511,026 R1841M possibly damaging Het
Dnhd1 T C 7: 105,687,377 L1213P probably damaging Het
Dscam A T 16: 96,829,900 I305K probably benign Het
Dsp A G 13: 38,192,217 E1326G possibly damaging Het
Emc9 A G 14: 55,584,910 probably null Het
Eppk1 A C 15: 76,111,926 S252A probably benign Het
Fn1 T A 1: 71,600,413 T1830S probably damaging Het
Fryl A T 5: 73,022,142 M2974K probably damaging Het
Gdpd3 C A 7: 126,771,029 S250* probably null Het
Gm13088 A T 4: 143,655,483 N214K probably damaging Het
Gm8994 T A 6: 136,328,619 V26E probably benign Het
Gnl3 A T 14: 31,013,179 S485R probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Hsd17b3 T C 13: 64,059,525 Y234C probably benign Het
Lima1 T C 15: 99,781,267 H271R possibly damaging Het
Nfu1 G A 6: 87,017,052 probably null Het
Noto A G 6: 85,427,960 E97G probably damaging Het
Ntng1 T C 3: 109,872,218 K348E probably damaging Het
Olfr1242 C T 2: 89,494,250 G21R possibly damaging Het
Olfr1383 G A 11: 49,523,709 probably benign Het
Papln A G 12: 83,777,460 E554G probably benign Het
Pitrm1 T C 13: 6,555,459 L175P probably damaging Het
Pramel7 T C 2: 87,489,726 T408A probably damaging Het
Serinc2 A T 4: 130,255,442 D322E probably benign Het
Setx T C 2: 29,148,108 V1535A probably benign Het
Sgce A T 6: 4,689,666 V389E probably damaging Het
Snx11 G A 11: 96,769,062 T267I probably benign Het
Specc1 G A 11: 62,118,336 S306N probably benign Het
Spocd1 A G 4: 129,956,512 probably benign Het
St7 T A 6: 17,854,946 V294D probably damaging Het
Stab1 C T 14: 31,158,963 R624Q probably benign Het
Tcf21 T C 10: 22,819,504 I134V probably benign Het
Tgfb2 T A 1: 186,632,500 I266F probably damaging Het
Tgfbr3l A G 8: 4,250,365 I209M possibly damaging Het
Tmcc3 A G 10: 94,551,172 probably null Het
Toe1 A G 4: 116,807,474 S16P probably damaging Het
Vps16 T C 2: 130,437,681 V38A possibly damaging Het
Wnk2 G T 13: 49,071,081 D1001E probably damaging Het
Other mutations in Osmr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Osmr APN 15 6844445 nonsense probably null
IGL00335:Osmr APN 15 6837023 missense probably benign 0.00
IGL00497:Osmr APN 15 6847066 missense probably benign 0.26
IGL00510:Osmr APN 15 6823631 nonsense probably null
IGL00811:Osmr APN 15 6815666 missense probably benign 0.28
IGL00959:Osmr APN 15 6824605 missense probably benign 0.12
IGL01115:Osmr APN 15 6847201 splice site probably benign
IGL01307:Osmr APN 15 6844427 missense probably damaging 1.00
IGL01330:Osmr APN 15 6842028 missense probably damaging 1.00
IGL01633:Osmr APN 15 6824604 missense probably damaging 1.00
IGL01780:Osmr APN 15 6828663 missense probably benign 0.00
IGL02164:Osmr APN 15 6842048 missense probably damaging 0.99
IGL02207:Osmr APN 15 6847147 missense probably benign 0.07
IGL02338:Osmr APN 15 6837729 nonsense probably null
IGL02350:Osmr APN 15 6828663 missense probably benign 0.00
IGL02357:Osmr APN 15 6828663 missense probably benign 0.00
IGL02545:Osmr APN 15 6823579 missense probably damaging 0.98
IGL02619:Osmr APN 15 6841994 missense probably damaging 1.00
IGL02685:Osmr APN 15 6815573 missense probably benign 0.00
IGL02959:Osmr APN 15 6815897 missense possibly damaging 0.93
IGL03303:Osmr APN 15 6842808 missense probably benign 0.03
FR4548:Osmr UTSW 15 6837703 small insertion probably benign
FR4737:Osmr UTSW 15 6837706 nonsense probably null
R0149:Osmr UTSW 15 6841951 critical splice donor site probably null
R0361:Osmr UTSW 15 6841951 critical splice donor site probably null
R0492:Osmr UTSW 15 6824518 missense probably damaging 1.00
R0538:Osmr UTSW 15 6841938 splice site probably benign
R0585:Osmr UTSW 15 6837793 missense probably benign
R0980:Osmr UTSW 15 6852440 missense probably benign 0.00
R1221:Osmr UTSW 15 6823561 nonsense probably null
R1922:Osmr UTSW 15 6844367 missense possibly damaging 0.67
R2067:Osmr UTSW 15 6815415 missense probably benign 0.00
R2136:Osmr UTSW 15 6852462 missense probably damaging 1.00
R2156:Osmr UTSW 15 6844410 missense probably benign 0.04
R3683:Osmr UTSW 15 6837053 missense possibly damaging 0.95
R3735:Osmr UTSW 15 6822080 missense probably damaging 1.00
R3736:Osmr UTSW 15 6822080 missense probably damaging 1.00
R4011:Osmr UTSW 15 6824533 missense probably benign 0.01
R4175:Osmr UTSW 15 6852546 missense probably damaging 1.00
R4555:Osmr UTSW 15 6815720 missense possibly damaging 0.73
R4581:Osmr UTSW 15 6842894 missense probably benign 0.00
R4751:Osmr UTSW 15 6842852 missense probably damaging 1.00
R4758:Osmr UTSW 15 6852555 missense probably benign 0.23
R4986:Osmr UTSW 15 6816580 critical splice donor site probably null
R4997:Osmr UTSW 15 6815639 missense probably benign 0.25
R5077:Osmr UTSW 15 6844393 nonsense probably null
R5093:Osmr UTSW 15 6821079 missense probably damaging 0.96
R5120:Osmr UTSW 15 6827275 missense probably benign 0.16
R5331:Osmr UTSW 15 6842881 missense probably damaging 1.00
R5812:Osmr UTSW 15 6837059 missense probably damaging 0.99
R5819:Osmr UTSW 15 6815787 missense probably benign 0.00
R5876:Osmr UTSW 15 6821047 missense probably benign 0.07
R5986:Osmr UTSW 15 6844453 missense probably benign 0.36
R6018:Osmr UTSW 15 6815795 missense probably damaging 1.00
R6164:Osmr UTSW 15 6860352 missense probably benign 0.00
R6217:Osmr UTSW 15 6823566 missense probably damaging 1.00
R6312:Osmr UTSW 15 6823638 missense probably damaging 1.00
R6349:Osmr UTSW 15 6821063 missense probably benign 0.00
R7139:Osmr UTSW 15 6821088 missense possibly damaging 0.79
R7412:Osmr UTSW 15 6823567 missense probably damaging 1.00
R7527:Osmr UTSW 15 6827122 missense probably damaging 1.00
R7630:Osmr UTSW 15 6816971 missense possibly damaging 0.53
R7730:Osmr UTSW 15 6824482 missense probably damaging 1.00
R7990:Osmr UTSW 15 6852467 missense possibly damaging 0.87
R8094:Osmr UTSW 15 6815621 missense possibly damaging 0.64
R8187:Osmr UTSW 15 6821004 missense probably damaging 1.00
R8260:Osmr UTSW 15 6815416 missense probably benign 0.41
R8366:Osmr UTSW 15 6820954 missense possibly damaging 0.82
R9051:Osmr UTSW 15 6852546 missense probably damaging 1.00
R9137:Osmr UTSW 15 6827228 missense probably benign 0.13
R9182:Osmr UTSW 15 6821088 missense probably damaging 1.00
R9238:Osmr UTSW 15 6816605 missense possibly damaging 0.90
R9260:Osmr UTSW 15 6852552 missense probably benign
R9559:Osmr UTSW 15 6852546 missense probably damaging 1.00
RF040:Osmr UTSW 15 6837701 small insertion probably benign
RF055:Osmr UTSW 15 6837700 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GCCAATAGTCCAAGTTGGTGTG -3'
(R):5'- TTGTCACAACCTTCAAGTTCAC -3'

Sequencing Primer
(F):5'- CCTGGAATGAGGCCATGG -3'
(R):5'- CTTCAAGTTCACATATGGCCAGG -3'
Posted On 2018-11-06