Incidental Mutation 'R6898:Eppk1'
ID538472
Institutional Source Beutler Lab
Gene Symbol Eppk1
Ensembl Gene ENSMUSG00000115388
Gene Nameepiplakin 1
SynonymsEPIPL1, EPPK
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.289) question?
Stock #R6898 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location76101481-76120195 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 76111926 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 252 (S252A)
Ref Sequence ENSEMBL: ENSMUSP00000154609 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000226781
AA Change: S252A

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the plakin family of proteins, which play a role in the organization of cytoskeletal architecture. This family member is composed of several highly homologous plakin repeats. It may function to maintain the integrity of keratin intermediate filament networks in epithelial cells. Studies of the orthologous mouse protein suggest that it accelerates keratinocyte migration during wound healing. [provided by RefSeq, Oct 2013]
PHENOTYPE: Mice homozygous for a null allele exhbit normal skin morphology. Mice homozygous for a reporter knock-in allele exhibit enhanced wound healing associated with increased keratinocyte migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,931,041 Y325F probably damaging Het
4430402I18Rik T G 19: 28,944,288 Q146P probably benign Het
Ankrd7 G T 6: 18,868,101 probably null Het
Aplnr A T 2: 85,139,811 probably benign Het
Capns2 T C 8: 92,901,977 S165P probably damaging Het
Col25a1 T C 3: 130,584,728 probably null Het
Crocc2 T C 1: 93,215,582 V1302A probably benign Het
Cul9 C A 17: 46,511,026 R1841M possibly damaging Het
Dnhd1 T C 7: 105,687,377 L1213P probably damaging Het
Dscam A T 16: 96,829,900 I305K probably benign Het
Dsp A G 13: 38,192,217 E1326G possibly damaging Het
Emc9 A G 14: 55,584,910 probably null Het
Fn1 T A 1: 71,600,413 T1830S probably damaging Het
Fryl A T 5: 73,022,142 M2974K probably damaging Het
Gdpd3 C A 7: 126,771,029 S250* probably null Het
Gm13088 A T 4: 143,655,483 N214K probably damaging Het
Gm8994 T A 6: 136,328,619 V26E probably benign Het
Gnl3 A T 14: 31,013,179 S485R probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Hsd17b3 T C 13: 64,059,525 Y234C probably benign Het
Lima1 T C 15: 99,781,267 H271R possibly damaging Het
Nfu1 G A 6: 87,017,052 probably null Het
Noto A G 6: 85,427,960 E97G probably damaging Het
Ntng1 T C 3: 109,872,218 K348E probably damaging Het
Olfr1242 C T 2: 89,494,250 G21R possibly damaging Het
Olfr1383 G A 11: 49,523,709 probably benign Het
Osmr C A 15: 6,815,883 V801F probably damaging Het
Papln A G 12: 83,777,460 E554G probably benign Het
Pitrm1 T C 13: 6,555,459 L175P probably damaging Het
Pramel7 T C 2: 87,489,726 T408A probably damaging Het
Serinc2 A T 4: 130,255,442 D322E probably benign Het
Setx T C 2: 29,148,108 V1535A probably benign Het
Sgce A T 6: 4,689,666 V389E probably damaging Het
Snx11 G A 11: 96,769,062 T267I probably benign Het
Specc1 G A 11: 62,118,336 S306N probably benign Het
Spocd1 A G 4: 129,956,512 probably benign Het
St7 T A 6: 17,854,946 V294D probably damaging Het
Stab1 C T 14: 31,158,963 R624Q probably benign Het
Tcf21 T C 10: 22,819,504 I134V probably benign Het
Tgfb2 T A 1: 186,632,500 I266F probably damaging Het
Tgfbr3l A G 8: 4,250,365 I209M possibly damaging Het
Tmcc3 A G 10: 94,551,172 probably null Het
Toe1 A G 4: 116,807,474 S16P probably damaging Het
Vps16 T C 2: 130,437,681 V38A possibly damaging Het
Wnk2 G T 13: 49,071,081 D1001E probably damaging Het
Other mutations in Eppk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT1430001:Eppk1 UTSW 15 76105236 missense probably benign 0.00
PIT4494001:Eppk1 UTSW 15 76106072 missense probably benign 0.03
R6981:Eppk1 UTSW 15 76111037 missense probably benign 0.03
R6999:Eppk1 UTSW 15 76109223 missense probably benign 0.03
R7162:Eppk1 UTSW 15 76106609 missense possibly damaging 0.83
R7169:Eppk1 UTSW 15 76105914 missense probably benign 0.05
R7352:Eppk1 UTSW 15 76106418 missense probably benign 0.01
R7528:Eppk1 UTSW 15 76120108 start gained probably benign
R7547:Eppk1 UTSW 15 76107540 missense probably benign 0.17
R7575:Eppk1 UTSW 15 76111242 missense not run
R7591:Eppk1 UTSW 15 76107597 missense possibly damaging 0.87
R7648:Eppk1 UTSW 15 76110671 missense probably benign 0.16
R7690:Eppk1 UTSW 15 76111746 missense probably benign 0.03
R7716:Eppk1 UTSW 15 76107503 nonsense probably null
R7999:Eppk1 UTSW 15 76109004 missense probably benign 0.03
R7999:Eppk1 UTSW 15 76109135 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CAAGTGTTCAACTGTAGCCTGG -3'
(R):5'- GCAGGGCCTTTTGGATAAGG -3'

Sequencing Primer
(F):5'- GCCTGGAAAAAGCTCTTCTTGTGAC -3'
(R):5'- CCTTTTGGATAAGGAGACATGGCTC -3'
Posted On2018-11-06