Incidental Mutation 'R6900:Saxo1'
ID538483
Institutional Source Beutler Lab
Gene Symbol Saxo1
Ensembl Gene ENSMUSG00000028492
Gene Namestabilizer of axonemal microtubules 1
Synonyms4930500O09Rik, Fam154a
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R6900 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location86444641-86558328 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86445334 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 304 (D304G)
Ref Sequence ENSEMBL: ENSMUSP00000030216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030216]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030216
AA Change: D304G

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030216
Gene: ENSMUSG00000028492
AA Change: D304G

DomainStartEndE-ValueType
Pfam:STOP 5 129 2.4e-13 PFAM
Pfam:STOP 88 265 1.6e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap10 T C 8: 77,310,862 D579G probably damaging Het
Cc2d2b A G 19: 40,825,074 S1333G probably null Het
Cep250 A G 2: 155,996,270 probably null Het
Chd3 T C 11: 69,354,445 D1149G possibly damaging Het
Dnah7a A G 1: 53,662,351 L215P probably damaging Het
Fbn2 T C 18: 58,076,831 M993V probably benign Het
Ggt5 A T 10: 75,610,537 Q523L possibly damaging Het
Hcn1 A G 13: 117,656,827 N205S probably benign Het
Htr1b A T 9: 81,631,570 I328N probably damaging Het
Itgav T A 2: 83,803,247 F980Y probably damaging Het
Kbtbd2 A G 6: 56,780,023 S243P probably damaging Het
Kcnd2 A G 6: 21,216,588 N97S probably damaging Het
Kif1bp T C 10: 62,559,129 Y578C probably damaging Het
Lars T C 18: 42,234,610 K468E probably benign Het
Map3k1 T C 13: 111,753,816 N1283S probably benign Het
Mapk8ip3 A T 17: 24,909,123 probably null Het
Mroh2b A G 15: 4,908,987 I253V probably benign Het
Nup98 A G 7: 102,185,962 F228S probably damaging Het
Olfr728 A T 14: 50,139,838 V267E possibly damaging Het
Pdzd2 A G 15: 12,374,037 F2004S probably benign Het
Pkhd1 A T 1: 20,534,701 L1130Q probably benign Het
Pparg G T 6: 115,472,988 R286L possibly damaging Het
Ppp1r16a A G 15: 76,691,723 S96G probably damaging Het
Psg29 C T 7: 17,204,932 Q44* probably null Het
Rgs22 A G 15: 36,010,747 F1227S possibly damaging Het
Sec14l1 T C 11: 117,117,223 Y12H probably damaging Het
Sh3bp4 A G 1: 89,145,767 N779S probably benign Het
Sin3a T C 9: 57,107,574 V693A probably damaging Het
Teddm1b G A 1: 153,875,210 C255Y probably benign Het
Ttk T A 9: 83,872,030 S819T probably damaging Het
Zfp362 C T 4: 128,786,015 C273Y probably damaging Het
Other mutations in Saxo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Saxo1 APN 4 86445572 missense probably damaging 1.00
IGL00563:Saxo1 APN 4 86445572 missense probably damaging 1.00
IGL01816:Saxo1 APN 4 86445614 missense probably benign 0.03
IGL02941:Saxo1 APN 4 86445584 missense probably damaging 1.00
IGL03139:Saxo1 APN 4 86487762 missense possibly damaging 0.49
R0498:Saxo1 UTSW 4 86478896 missense possibly damaging 0.78
R0522:Saxo1 UTSW 4 86445103 missense probably damaging 1.00
R1126:Saxo1 UTSW 4 86478987 missense probably benign 0.30
R2203:Saxo1 UTSW 4 86445761 missense probably damaging 1.00
R2261:Saxo1 UTSW 4 86478975 missense probably damaging 1.00
R2262:Saxo1 UTSW 4 86478975 missense probably damaging 1.00
R4017:Saxo1 UTSW 4 86557996 missense possibly damaging 0.82
R4629:Saxo1 UTSW 4 86487827 missense probably damaging 1.00
R5199:Saxo1 UTSW 4 86487782 missense probably damaging 1.00
R5471:Saxo1 UTSW 4 86445724 missense probably damaging 1.00
R5626:Saxo1 UTSW 4 86445589 missense probably damaging 1.00
R5679:Saxo1 UTSW 4 86445035 missense possibly damaging 0.89
R5710:Saxo1 UTSW 4 86445035 missense possibly damaging 0.89
R5782:Saxo1 UTSW 4 86445807 missense probably damaging 0.96
R7035:Saxo1 UTSW 4 86445122 missense probably damaging 1.00
R7491:Saxo1 UTSW 4 86445407 missense probably benign 0.27
Z1176:Saxo1 UTSW 4 86445803 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AAGGTTCAGCAGGCAAGCTC -3'
(R):5'- ACATCCCCTTTGAGAACCTG -3'

Sequencing Primer
(F):5'- TCAGCAGGCAAGCTCAGGTG -3'
(R):5'- AAAGAGTCCTACCGAGGCCTG -3'
Posted On2018-11-06