Incidental Mutation 'R6900:Kcnd2'
ID538485
Institutional Source Beutler Lab
Gene Symbol Kcnd2
Ensembl Gene ENSMUSG00000060882
Gene Namepotassium voltage-gated channel, Shal-related family, member 2
SynonymsKv4.2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R6900 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location21215503-21729805 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21216588 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 97 (N97S)
Ref Sequence ENSEMBL: ENSMUSP00000080257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081542]
Predicted Effect probably damaging
Transcript: ENSMUST00000081542
AA Change: N97S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080257
Gene: ENSMUSG00000060882
AA Change: N97S

DomainStartEndE-ValueType
Pfam:Shal-type 3 31 4.5e-16 PFAM
BTB 41 140 3.42e-14 SMART
Pfam:Ion_trans 184 417 1.4e-44 PFAM
Pfam:Ion_trans_2 330 411 5.5e-15 PFAM
low complexity region 418 437 N/A INTRINSIC
Pfam:DUF3399 445 546 5.5e-44 PFAM
low complexity region 594 608 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This member mediates a rapidly inactivating, A-type outward potassium current which is not under the control of the N terminus as it is in Shaker channels. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene reduces A-type currents in spinal cord dorsal horn neurons and increases their excitability, resulting in enhanced sensitivity to tactile and thermal stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap10 T C 8: 77,310,862 D579G probably damaging Het
Cc2d2b A G 19: 40,825,074 S1333G probably null Het
Cep250 A G 2: 155,996,270 probably null Het
Chd3 T C 11: 69,354,445 D1149G possibly damaging Het
Dnah7a A G 1: 53,662,351 L215P probably damaging Het
Fbn2 T C 18: 58,076,831 M993V probably benign Het
Ggt5 A T 10: 75,610,537 Q523L possibly damaging Het
Hcn1 A G 13: 117,656,827 N205S probably benign Het
Htr1b A T 9: 81,631,570 I328N probably damaging Het
Itgav T A 2: 83,803,247 F980Y probably damaging Het
Kbtbd2 A G 6: 56,780,023 S243P probably damaging Het
Kif1bp T C 10: 62,559,129 Y578C probably damaging Het
Lars T C 18: 42,234,610 K468E probably benign Het
Map3k1 T C 13: 111,753,816 N1283S probably benign Het
Mapk8ip3 A T 17: 24,909,123 probably null Het
Mroh2b A G 15: 4,908,987 I253V probably benign Het
Nup98 A G 7: 102,185,962 F228S probably damaging Het
Olfr728 A T 14: 50,139,838 V267E possibly damaging Het
Pdzd2 A G 15: 12,374,037 F2004S probably benign Het
Pkhd1 A T 1: 20,534,701 L1130Q probably benign Het
Pparg G T 6: 115,472,988 R286L possibly damaging Het
Ppp1r16a A G 15: 76,691,723 S96G probably damaging Het
Psg29 C T 7: 17,204,932 Q44* probably null Het
Rgs22 A G 15: 36,010,747 F1227S possibly damaging Het
Saxo1 T C 4: 86,445,334 D304G possibly damaging Het
Sec14l1 T C 11: 117,117,223 Y12H probably damaging Het
Sh3bp4 A G 1: 89,145,767 N779S probably benign Het
Sin3a T C 9: 57,107,574 V693A probably damaging Het
Teddm1b G A 1: 153,875,210 C255Y probably benign Het
Ttk T A 9: 83,872,030 S819T probably damaging Het
Zfp362 C T 4: 128,786,015 C273Y probably damaging Het
Other mutations in Kcnd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Kcnd2 APN 6 21714154 missense possibly damaging 0.90
IGL01124:Kcnd2 APN 6 21217217 missense probably damaging 1.00
IGL01317:Kcnd2 APN 6 21727340 makesense probably null
IGL01534:Kcnd2 APN 6 21726145 missense probably benign
IGL02623:Kcnd2 APN 6 21726195 missense probably benign 0.05
IGL02682:Kcnd2 APN 6 21216925 nonsense probably null
IGL02874:Kcnd2 APN 6 21216923 missense probably damaging 1.00
IGL02982:Kcnd2 APN 6 21217149 missense probably damaging 1.00
IGL02983:Kcnd2 APN 6 21216555 missense probably damaging 1.00
IGL03119:Kcnd2 APN 6 21216509 nonsense probably null
IGL03154:Kcnd2 APN 6 21216708 missense probably damaging 1.00
IGL03174:Kcnd2 APN 6 21216516 missense possibly damaging 0.93
IGL03296:Kcnd2 APN 6 21714209 missense probably damaging 1.00
R0062:Kcnd2 UTSW 6 21727226 missense possibly damaging 0.80
R0062:Kcnd2 UTSW 6 21727226 missense possibly damaging 0.80
R0325:Kcnd2 UTSW 6 21216683 missense probably damaging 0.99
R0771:Kcnd2 UTSW 6 21216442 missense probably damaging 1.00
R0836:Kcnd2 UTSW 6 21726239 splice site probably benign
R0836:Kcnd2 UTSW 6 21727329 missense probably damaging 1.00
R0884:Kcnd2 UTSW 6 21216541 missense probably benign
R1434:Kcnd2 UTSW 6 21216357 missense probably damaging 1.00
R2116:Kcnd2 UTSW 6 21216432 missense probably damaging 1.00
R3863:Kcnd2 UTSW 6 21217263 nonsense probably null
R3939:Kcnd2 UTSW 6 21217096 missense probably damaging 1.00
R4427:Kcnd2 UTSW 6 21216897 missense probably damaging 0.99
R4561:Kcnd2 UTSW 6 21216396 missense probably benign
R4707:Kcnd2 UTSW 6 21723212 missense probably benign
R5523:Kcnd2 UTSW 6 21723212 missense probably benign
R5545:Kcnd2 UTSW 6 21217019 missense probably damaging 1.00
R5926:Kcnd2 UTSW 6 21217085 missense probably damaging 0.99
R7010:Kcnd2 UTSW 6 21216708 missense probably damaging 1.00
R7028:Kcnd2 UTSW 6 21216178 start gained probably benign
R7183:Kcnd2 UTSW 6 21216437 missense probably damaging 1.00
R7387:Kcnd2 UTSW 6 21216778 missense probably benign 0.28
R7463:Kcnd2 UTSW 6 21216498 missense probably damaging 1.00
R8007:Kcnd2 UTSW 6 21217074 missense probably damaging 0.99
R8305:Kcnd2 UTSW 6 21726198 nonsense probably null
X0021:Kcnd2 UTSW 6 21217323 missense probably damaging 0.99
Z1177:Kcnd2 UTSW 6 21216416 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCTCTGATAGTGCTGAACG -3'
(R):5'- GTGTGGGGATTCTCAAAGGC -3'

Sequencing Primer
(F):5'- GTGAGTGGCACCCGTTTC -3'
(R):5'- GATTCTCAAAGGCCCGCCAG -3'
Posted On2018-11-06