Mutagenetix > Incidental Mutations

Incidental Mutation 'R6900:Pparg'

538487

Institutional Source

Beutler Lab

Gene Symbol

Pparg

Ensembl Gene

ENSMUSG00000000440

Gene Name

peroxisome proliferator activated receptor gamma

Synonyms

Ppar-gamma2, PPAR-gamma, Nr1c3, PPARgamma, PPARgamma2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6900 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

115360951-115490399 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 115472988 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 286 (R286L)

Ref Sequence

ENSEMBL: ENSMUSP00000145525 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000450] [ENSMUST00000171644] [ENSMUST00000203732]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000000450
AA Change: R316L

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000000450
Gene: ENSMUSG00000000440
AA Change: R316L

Domain	Start	End	E-Value	Type
Pfam:PPARgamma_N	31	108	1.1e-35	PFAM
ZnF_C4	136	206	2.61e-34	SMART
HOLI	315	474	9.89e-26	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000171644
AA Change: R286L

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000131962
Gene: ENSMUSG00000000440
AA Change: R286L

Domain	Start	End	E-Value	Type
Pfam:PPARgamma_N	1	78	3.1e-36	PFAM
ZnF_C4	106	176	2.61e-34	SMART
HOLI	285	444	9.89e-26	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000203732
AA Change: R286L

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000145525
Gene: ENSMUSG00000000440
AA Change: R286L

Domain	Start	End	E-Value	Type
Pfam:PPARgamma_N	1	78	2e-35	PFAM
ZnF_C4	106	176	2.61e-34	SMART
HOLI	285	444	9.89e-26	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.7%

Validation Efficiency

100% (32/32)

MGI Phenotype

FUNCTION: This gene encodes a nuclear receptor protein belonging to the peroxisome proliferator-activated receptor (Ppar) family. The encoded protein is a ligand-activated transcription factor that is involved in the regulation of adipocyte differentiation and glucose homeostasis. The encoded protein forms a heterodimer with retinoid X receptors and binds to DNA motifs termed "peroxisome proliferator response elements" to either activate or inhibit gene expression. Mice lacking the encoded protein die at an embryonic stage due to severe defects in placental vascularization. When the embryos lacking this gene are supplemented with healthy placentas, the mutants survive to term, but succumb to lipodystrophy and multiple hemorrhages. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit lethality due to placental defects. Heterozygotes show greater B cell proliferation, enhanced leptin secretion, and resistance to diet-induced adipocyte hypertrophy and insulin resistance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgap10	T	C	8: 77,310,862	D579G	probably damaging	Het
Cc2d2b	A	G	19: 40,825,074	S1333G	probably null	Het
Cep250	A	G	2: 155,996,270		probably null	Het
Chd3	T	C	11: 69,354,445	D1149G	possibly damaging	Het
Dnah7a	A	G	1: 53,662,351	L215P	probably damaging	Het
Fbn2	T	C	18: 58,076,831	M993V	probably benign	Het
Ggt5	A	T	10: 75,610,537	Q523L	possibly damaging	Het
Hcn1	A	G	13: 117,656,827	N205S	probably benign	Het
Htr1b	A	T	9: 81,631,570	I328N	probably damaging	Het
Itgav	T	A	2: 83,803,247	F980Y	probably damaging	Het
Kbtbd2	A	G	6: 56,780,023	S243P	probably damaging	Het
Kcnd2	A	G	6: 21,216,588	N97S	probably damaging	Het
Kif1bp	T	C	10: 62,559,129	Y578C	probably damaging	Het
Lars	T	C	18: 42,234,610	K468E	probably benign	Het
Map3k1	T	C	13: 111,753,816	N1283S	probably benign	Het
Mapk8ip3	A	T	17: 24,909,123		probably null	Het
Mroh2b	A	G	15: 4,908,987	I253V	probably benign	Het
Nup98	A	G	7: 102,185,962	F228S	probably damaging	Het
Olfr728	A	T	14: 50,139,838	V267E	possibly damaging	Het
Pdzd2	A	G	15: 12,374,037	F2004S	probably benign	Het
Pkhd1	A	T	1: 20,534,701	L1130Q	probably benign	Het
Ppp1r16a	A	G	15: 76,691,723	S96G	probably damaging	Het
Psg29	C	T	7: 17,204,932	Q44*	probably null	Het
Rgs22	A	G	15: 36,010,747	F1227S	possibly damaging	Het
Saxo1	T	C	4: 86,445,334	D304G	possibly damaging	Het
Sec14l1	T	C	11: 117,117,223	Y12H	probably damaging	Het
Sh3bp4	A	G	1: 89,145,767	N779S	probably benign	Het
Sin3a	T	C	9: 57,107,574	V693A	probably damaging	Het
Teddm1b	G	A	1: 153,875,210	C255Y	probably benign	Het
Ttk	T	A	9: 83,872,030	S819T	probably damaging	Het
Zfp362	C	T	4: 128,786,015	C273Y	probably damaging	Het

Other mutations in Pparg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00906:Pparg	APN	6	115439861	missense	probably damaging	0.99
IGL00938:Pparg	APN	6	115463139	missense	probably benign	0.09
IGL01303:Pparg	APN	6	115472954	missense	possibly damaging	0.89
IGL01454:Pparg	APN	6	115439939	missense	probably damaging	1.00
IGL01552:Pparg	APN	6	115490122	missense	probably benign	0.00
IGL02998:Pparg	APN	6	115463088	missense	probably benign	0.01
IGL03167:Pparg	APN	6	115473227	missense	probably damaging	1.00
IGL03179:Pparg	APN	6	115439872	missense	probably damaging	1.00
Energy	UTSW	6	115451044	missense	probably damaging	1.00
R1083:Pparg	UTSW	6	115490146	missense	probably damaging	0.99
R1569:Pparg	UTSW	6	115439999	missense	probably benign	0.14
R1620:Pparg	UTSW	6	115473281	missense	probably benign	0.01
R1850:Pparg	UTSW	6	115450980	missense	probably damaging	1.00
R2339:Pparg	UTSW	6	115451044	missense	probably damaging	1.00
R4429:Pparg	UTSW	6	115440023	missense	probably benign	0.09
R4941:Pparg	UTSW	6	115490110	missense	probably damaging	1.00
R4946:Pparg	UTSW	6	115451028	missense	probably damaging	1.00
R5110:Pparg	UTSW	6	115473003	missense	probably damaging	1.00
R5523:Pparg	UTSW	6	115490071	missense	probably damaging	1.00
R6994:Pparg	UTSW	6	115451050	missense	probably benign	0.36
R7177:Pparg	UTSW	6	115441620	missense	probably benign	0.40
R7755:Pparg	UTSW	6	115463106	missense	probably damaging	1.00
R8103:Pparg	UTSW	6	115473141	missense	possibly damaging	0.91
R8496:Pparg	UTSW	6	115463151	missense	probably benign	0.00
R8914:Pparg	UTSW	6	115463172	missense	probably benign	0.00
R8953:Pparg	UTSW	6	115441546	missense	possibly damaging	0.86
X0064:Pparg	UTSW	6	115439914	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ATGCTCTCTCAGAACAAGGAACTC -3'
(R):5'- AAGTCACCAAAGGGCTTCCG -3'

Sequencing Primer
(F):5'- GGAACTCAGCCACTTTCCC -3'
(R):5'- GGAACTCCCTGGTCATGAATC -3'

Posted On

2018-11-06