Incidental Mutation 'R6900:Psg29'
ID538488
Institutional Source Beutler Lab
Gene Symbol Psg29
Ensembl Gene ENSMUSG00000023159
Gene Namepregnancy-specific glycoprotein 29
Synonymscea17
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R6900 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location17203477-17215760 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 17204932 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 44 (Q44*)
Ref Sequence ENSEMBL: ENSMUSP00000075320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075934]
Predicted Effect probably null
Transcript: ENSMUST00000075934
AA Change: Q44*
SMART Domains Protein: ENSMUSP00000075320
Gene: ENSMUSG00000023159
AA Change: Q44*

DomainStartEndE-ValueType
IG 40 137 7.77e-1 SMART
IG 156 257 8.72e-4 SMART
IG 276 377 2.44e0 SMART
IGc2 393 457 3.06e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap10 T C 8: 77,310,862 D579G probably damaging Het
Cc2d2b A G 19: 40,825,074 S1333G probably null Het
Cep250 A G 2: 155,996,270 probably null Het
Chd3 T C 11: 69,354,445 D1149G possibly damaging Het
Dnah7a A G 1: 53,662,351 L215P probably damaging Het
Fbn2 T C 18: 58,076,831 M993V probably benign Het
Ggt5 A T 10: 75,610,537 Q523L possibly damaging Het
Hcn1 A G 13: 117,656,827 N205S probably benign Het
Htr1b A T 9: 81,631,570 I328N probably damaging Het
Itgav T A 2: 83,803,247 F980Y probably damaging Het
Kbtbd2 A G 6: 56,780,023 S243P probably damaging Het
Kcnd2 A G 6: 21,216,588 N97S probably damaging Het
Kif1bp T C 10: 62,559,129 Y578C probably damaging Het
Lars T C 18: 42,234,610 K468E probably benign Het
Map3k1 T C 13: 111,753,816 N1283S probably benign Het
Mapk8ip3 A T 17: 24,909,123 probably null Het
Mroh2b A G 15: 4,908,987 I253V probably benign Het
Nup98 A G 7: 102,185,962 F228S probably damaging Het
Olfr728 A T 14: 50,139,838 V267E possibly damaging Het
Pdzd2 A G 15: 12,374,037 F2004S probably benign Het
Pkhd1 A T 1: 20,534,701 L1130Q probably benign Het
Pparg G T 6: 115,472,988 R286L possibly damaging Het
Ppp1r16a A G 15: 76,691,723 S96G probably damaging Het
Rgs22 A G 15: 36,010,747 F1227S possibly damaging Het
Saxo1 T C 4: 86,445,334 D304G possibly damaging Het
Sec14l1 T C 11: 117,117,223 Y12H probably damaging Het
Sh3bp4 A G 1: 89,145,767 N779S probably benign Het
Sin3a T C 9: 57,107,574 V693A probably damaging Het
Teddm1b G A 1: 153,875,210 C255Y probably benign Het
Ttk T A 9: 83,872,030 S819T probably damaging Het
Zfp362 C T 4: 128,786,015 C273Y probably damaging Het
Other mutations in Psg29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Psg29 APN 7 17208732 missense probably benign 0.42
IGL01107:Psg29 APN 7 17204925 missense probably benign 0.01
IGL01348:Psg29 APN 7 17210673 missense probably benign 0.09
IGL01353:Psg29 APN 7 17205013 missense possibly damaging 0.54
IGL02546:Psg29 APN 7 17208782 missense probably damaging 1.00
IGL02611:Psg29 APN 7 17208791 missense probably benign 0.15
IGL02982:Psg29 APN 7 17211707 missense probably damaging 0.98
IGL03072:Psg29 APN 7 17208794 missense probably benign 0.06
macular UTSW 7 17210535 missense probably benign 0.23
papular UTSW 7 17211912 makesense probably null
R1744:Psg29 UTSW 7 17210353 missense probably damaging 1.00
R2272:Psg29 UTSW 7 17210696 missense probably benign 0.19
R3054:Psg29 UTSW 7 17208802 missense probably benign 0.29
R3790:Psg29 UTSW 7 17205025 missense possibly damaging 0.71
R3963:Psg29 UTSW 7 17208585 missense probably benign 0.01
R4464:Psg29 UTSW 7 17210650 missense possibly damaging 0.61
R4740:Psg29 UTSW 7 17208533 missense probably benign 0.00
R4774:Psg29 UTSW 7 17210535 missense probably benign 0.23
R4902:Psg29 UTSW 7 17211912 makesense probably null
R4977:Psg29 UTSW 7 17208631 missense probably damaging 1.00
R5071:Psg29 UTSW 7 17211838 missense probably damaging 1.00
R5072:Psg29 UTSW 7 17211838 missense probably damaging 1.00
R5074:Psg29 UTSW 7 17211838 missense probably damaging 1.00
R5169:Psg29 UTSW 7 17211653 missense probably damaging 1.00
R5415:Psg29 UTSW 7 17211636 splice site probably null
R5729:Psg29 UTSW 7 17210534 missense probably damaging 0.98
R6023:Psg29 UTSW 7 17210512 missense possibly damaging 0.82
R6127:Psg29 UTSW 7 17211746 missense probably benign 0.00
R7142:Psg29 UTSW 7 17210621 missense probably damaging 1.00
R7297:Psg29 UTSW 7 17210691 nonsense probably null
R7448:Psg29 UTSW 7 17211723 missense possibly damaging 0.90
R7973:Psg29 UTSW 7 17210537 missense probably benign 0.03
R8027:Psg29 UTSW 7 17208640 missense possibly damaging 0.69
X0017:Psg29 UTSW 7 17210661 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGTCATGTTGCTCACCTCC -3'
(R):5'- AGGGTGTAATAACCTCTGTCCTTC -3'

Sequencing Primer
(F):5'- TGCTCACCTCCATTAAGCAGGG -3'
(R):5'- ACATTGTGGATCATCAGGGATC -3'
Posted On2018-11-06