Mutagenetix > Incidental Mutations

Incidental Mutation 'R6900:Ggt5'

538495

Institutional Source

Beutler Lab

Gene Symbol

Ggt5

Ensembl Gene

ENSMUSG00000006344

Gene Name

gamma-glutamyltransferase 5

Synonyms

GGL, Ggtla1, GGT-REL, gamma-glutamyl leukotrienase

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6900 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

75589340-75617200 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 75610537 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 523 (Q523L)

Ref Sequence

ENSEMBL: ENSMUSP00000072074 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072217] [ENSMUST00000218807]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000072217
AA Change: Q523L

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000072074
Gene: ENSMUSG00000006344
AA Change: Q523L

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:G_glu_transpept	58	568	1.6e-164	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000218807

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.7%

Validation Efficiency

100% (32/32)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the gamma-glutamyl transpeptidase gene family, and some reports indicate that it is capable of cleaving the gamma-glutamyl moiety of glutathione. The protein encoded by this gene is synthesized as a single, catalytically-inactive polypeptide, that is processed post-transcriptionally to form a heavy and light subunit, with the catalytic activity contained within the small subunit. The encoded enzyme is able to convert leukotriene C4 to leukotriene D4, but appears to have distinct substrate specificity compared to gamma-glutamyl transpeptidase. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous mutants show an attenuation in neutrophil recruitment in an experimental model of peritonitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgap10	T	C	8: 77,310,862	D579G	probably damaging	Het
Cc2d2b	A	G	19: 40,825,074	S1333G	probably null	Het
Cep250	A	G	2: 155,996,270		probably null	Het
Chd3	T	C	11: 69,354,445	D1149G	possibly damaging	Het
Dnah7a	A	G	1: 53,662,351	L215P	probably damaging	Het
Fbn2	T	C	18: 58,076,831	M993V	probably benign	Het
Hcn1	A	G	13: 117,656,827	N205S	probably benign	Het
Htr1b	A	T	9: 81,631,570	I328N	probably damaging	Het
Itgav	T	A	2: 83,803,247	F980Y	probably damaging	Het
Kbtbd2	A	G	6: 56,780,023	S243P	probably damaging	Het
Kcnd2	A	G	6: 21,216,588	N97S	probably damaging	Het
Kif1bp	T	C	10: 62,559,129	Y578C	probably damaging	Het
Lars	T	C	18: 42,234,610	K468E	probably benign	Het
Map3k1	T	C	13: 111,753,816	N1283S	probably benign	Het
Mapk8ip3	A	T	17: 24,909,123		probably null	Het
Mroh2b	A	G	15: 4,908,987	I253V	probably benign	Het
Nup98	A	G	7: 102,185,962	F228S	probably damaging	Het
Olfr728	A	T	14: 50,139,838	V267E	possibly damaging	Het
Pdzd2	A	G	15: 12,374,037	F2004S	probably benign	Het
Pkhd1	A	T	1: 20,534,701	L1130Q	probably benign	Het
Pparg	G	T	6: 115,472,988	R286L	possibly damaging	Het
Ppp1r16a	A	G	15: 76,691,723	S96G	probably damaging	Het
Psg29	C	T	7: 17,204,932	Q44*	probably null	Het
Rgs22	A	G	15: 36,010,747	F1227S	possibly damaging	Het
Saxo1	T	C	4: 86,445,334	D304G	possibly damaging	Het
Sec14l1	T	C	11: 117,117,223	Y12H	probably damaging	Het
Sh3bp4	A	G	1: 89,145,767	N779S	probably benign	Het
Sin3a	T	C	9: 57,107,574	V693A	probably damaging	Het
Teddm1b	G	A	1: 153,875,210	C255Y	probably benign	Het
Ttk	T	A	9: 83,872,030	S819T	probably damaging	Het
Zfp362	C	T	4: 128,786,015	C273Y	probably damaging	Het

Other mutations in Ggt5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01503:Ggt5	APN	10	75610110	splice site	probably benign
IGL01926:Ggt5	APN	10	75604101	missense	probably benign	0.00
IGL02095:Ggt5	APN	10	75608803	missense	probably benign	0.01
IGL02252:Ggt5	APN	10	75602732	missense	possibly damaging	0.51
IGL02393:Ggt5	APN	10	75610237	splice site	probably benign
IGL02515:Ggt5	APN	10	75589770	missense	probably benign	0.23
IGL02528:Ggt5	APN	10	75610420	splice site	probably benign
IGL02964:Ggt5	APN	10	75604128	missense	probably benign	0.08
R0646:Ggt5	UTSW	10	75602648	missense	probably damaging	0.99
R0834:Ggt5	UTSW	10	75604770	missense	possibly damaging	0.73
R1454:Ggt5	UTSW	10	75609908	missense	probably benign	0.01
R1650:Ggt5	UTSW	10	75604761	missense	probably benign	0.00
R1846:Ggt5	UTSW	10	75610542	splice site	probably null
R1896:Ggt5	UTSW	10	75604726	missense	probably damaging	1.00
R2044:Ggt5	UTSW	10	75604087	missense	probably damaging	0.97
R2357:Ggt5	UTSW	10	75609241	missense	probably benign	0.19
R3151:Ggt5	UTSW	10	75609242	missense	probably benign	0.35
R4667:Ggt5	UTSW	10	75603031	missense	probably damaging	1.00
R4669:Ggt5	UTSW	10	75603031	missense	probably damaging	1.00
R5060:Ggt5	UTSW	10	75604774	missense	probably benign
R5756:Ggt5	UTSW	10	75604773	missense	probably benign
R6156:Ggt5	UTSW	10	75609326	missense	probably damaging	1.00
R6162:Ggt5	UTSW	10	75589792	missense	possibly damaging	0.92
R8258:Ggt5	UTSW	10	75614832	missense	probably benign	0.04
R8259:Ggt5	UTSW	10	75614832	missense	probably benign	0.04
R9001:Ggt5	UTSW	10	75610158	missense	probably benign	0.21
Z1088:Ggt5	UTSW	10	75608759	missense	possibly damaging	0.81
Z1176:Ggt5	UTSW	10	75602618	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGGCTAGAGTGTTCCCTCTC -3'
(R):5'- CACGGTTTTGAAGTCCTCCAC -3'

Sequencing Primer
(F):5'- TCCCGCGAAACTCCCTG -3'
(R):5'- TTGAAGTCCTCCACCTGGG -3'

Posted On

2018-11-06