Mutagenetix > Incidental Mutations

Incidental Mutation 'R6900:Map3k1'

538498

Institutional Source

Beutler Lab

Gene Symbol

Map3k1

Ensembl Gene

ENSMUSG00000021754

Gene Name

mitogen-activated protein kinase kinase kinase 1

Synonyms

Mekk, MEKK1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.937) question?

Stock #

R6900 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

111746428-111808993 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 111753816 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 1283 (N1283S)

Ref Sequence

ENSEMBL: ENSMUSP00000104890 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109267]

Predicted Effect

probably benign
Transcript: ENSMUST00000109267
AA Change: N1283S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000104890
Gene: ENSMUSG00000021754
AA Change: N1283S

Domain	Start	End	E-Value	Type
low complexity region	2	46	N/A	INTRINSIC
low complexity region	85	101	N/A	INTRINSIC
low complexity region	112	122	N/A	INTRINSIC
low complexity region	138	158	N/A	INTRINSIC
low complexity region	235	256	N/A	INTRINSIC
Pfam:SWIM	333	361	3.1e-7	PFAM
low complexity region	417	426	N/A	INTRINSIC
RING	438	486	2.69e-1	SMART
low complexity region	512	527	N/A	INTRINSIC
low complexity region	596	625	N/A	INTRINSIC
low complexity region	750	762	N/A	INTRINSIC
low complexity region	967	978	N/A	INTRINSIC
low complexity region	1073	1084	N/A	INTRINSIC
low complexity region	1160	1178	N/A	INTRINSIC
S_TKc	1224	1489	9.58e-85	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.7%

Validation Efficiency

100% (32/32)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase and is part of some signal transduction cascades, including the ERK and JNK kinase pathways as well as the NF-kappa-B pathway. The encoded protein is activated by autophosphorylation and requires magnesium as a cofactor in phosphorylating other proteins. This protein has E3 ligase activity conferred by a plant homeodomain (PHD) in its N-terminus and phospho-kinase activity conferred by a kinase domain in its C-terminus. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a spontaneous allele are born with one or both eyes open, defects in eye morphology, and defects in ear morphology and function. Mice homozygous for a knock-out allele are born with open eyes and exhibit increased response to aortic banding and blood vessel healing. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgap10	T	C	8: 77,310,862	D579G	probably damaging	Het
Cc2d2b	A	G	19: 40,825,074	S1333G	probably null	Het
Cep250	A	G	2: 155,996,270		probably null	Het
Chd3	T	C	11: 69,354,445	D1149G	possibly damaging	Het
Dnah7a	A	G	1: 53,662,351	L215P	probably damaging	Het
Fbn2	T	C	18: 58,076,831	M993V	probably benign	Het
Ggt5	A	T	10: 75,610,537	Q523L	possibly damaging	Het
Hcn1	A	G	13: 117,656,827	N205S	probably benign	Het
Htr1b	A	T	9: 81,631,570	I328N	probably damaging	Het
Itgav	T	A	2: 83,803,247	F980Y	probably damaging	Het
Kbtbd2	A	G	6: 56,780,023	S243P	probably damaging	Het
Kcnd2	A	G	6: 21,216,588	N97S	probably damaging	Het
Kif1bp	T	C	10: 62,559,129	Y578C	probably damaging	Het
Lars	T	C	18: 42,234,610	K468E	probably benign	Het
Mapk8ip3	A	T	17: 24,909,123		probably null	Het
Mroh2b	A	G	15: 4,908,987	I253V	probably benign	Het
Nup98	A	G	7: 102,185,962	F228S	probably damaging	Het
Olfr728	A	T	14: 50,139,838	V267E	possibly damaging	Het
Pdzd2	A	G	15: 12,374,037	F2004S	probably benign	Het
Pkhd1	A	T	1: 20,534,701	L1130Q	probably benign	Het
Pparg	G	T	6: 115,472,988	R286L	possibly damaging	Het
Ppp1r16a	A	G	15: 76,691,723	S96G	probably damaging	Het
Psg29	C	T	7: 17,204,932	Q44*	probably null	Het
Rgs22	A	G	15: 36,010,747	F1227S	possibly damaging	Het
Saxo1	T	C	4: 86,445,334	D304G	possibly damaging	Het
Sec14l1	T	C	11: 117,117,223	Y12H	probably damaging	Het
Sh3bp4	A	G	1: 89,145,767	N779S	probably benign	Het
Sin3a	T	C	9: 57,107,574	V693A	probably damaging	Het
Teddm1b	G	A	1: 153,875,210	C255Y	probably benign	Het
Ttk	T	A	9: 83,872,030	S819T	probably damaging	Het
Zfp362	C	T	4: 128,786,015	C273Y	probably damaging	Het

Other mutations in Map3k1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01594:Map3k1	APN	13	111758189	critical splice acceptor site	probably null
IGL01686:Map3k1	APN	13	111754662	missense	possibly damaging	0.51
IGL02104:Map3k1	APN	13	111756243	missense	probably damaging	0.99
IGL03071:Map3k1	APN	13	111755525	missense	possibly damaging	0.77
IGL03087:Map3k1	APN	13	111749025	missense	probably benign	0.01
IGL03213:Map3k1	APN	13	111748892	utr 3 prime	probably benign
Nepal	UTSW	13	111752449	missense	probably benign	0.07
Snow_leopard	UTSW	13	111755764	nonsense	probably null
R0005:Map3k1	UTSW	13	111755704	missense	probably benign	0.00
R0025:Map3k1	UTSW	13	111756129	missense	probably benign
R0506:Map3k1	UTSW	13	111755764	nonsense	probably null
R0540:Map3k1	UTSW	13	111763510	missense	probably benign	0.05
R0607:Map3k1	UTSW	13	111763510	missense	probably benign	0.05
R0898:Map3k1	UTSW	13	111767956	unclassified	probably benign
R1171:Map3k1	UTSW	13	111755643	missense	probably benign	0.29
R1464:Map3k1	UTSW	13	111755871	missense	possibly damaging	0.67
R1464:Map3k1	UTSW	13	111755871	missense	possibly damaging	0.67
R1682:Map3k1	UTSW	13	111757150	missense	probably damaging	1.00
R1718:Map3k1	UTSW	13	111755419	missense	probably benign	0.23
R1893:Map3k1	UTSW	13	111768033	missense	possibly damaging	0.91
R2174:Map3k1	UTSW	13	111752482	missense	possibly damaging	0.75
R2215:Map3k1	UTSW	13	111755788	missense	probably benign	0.00
R2239:Map3k1	UTSW	13	111748944	missense	probably benign	0.00
R3686:Map3k1	UTSW	13	111753891	missense	probably damaging	0.99
R3783:Map3k1	UTSW	13	111756220	missense	probably benign	0.00
R4094:Map3k1	UTSW	13	111756162	missense	possibly damaging	0.48
R4231:Map3k1	UTSW	13	111768494	missense	probably benign	0.01
R4902:Map3k1	UTSW	13	111772612	missense	probably damaging	0.99
R4967:Map3k1	UTSW	13	111772738	missense	probably damaging	0.96
R5465:Map3k1	UTSW	13	111756120	missense	probably benign	0.20
R5855:Map3k1	UTSW	13	111755979	missense	probably benign	0.37
R6384:Map3k1	UTSW	13	111750530	missense	probably damaging	1.00
R6389:Map3k1	UTSW	13	111769441	missense	probably damaging	1.00
R6400:Map3k1	UTSW	13	111755725	missense	probably damaging	0.99
R6509:Map3k1	UTSW	13	111753829	missense	possibly damaging	0.48
R6644:Map3k1	UTSW	13	111752449	missense	probably benign	0.07
R6943:Map3k1	UTSW	13	111772712	missense	probably benign	0.30
R6946:Map3k1	UTSW	13	111768501	nonsense	probably null
R7059:Map3k1	UTSW	13	111772778	missense	probably benign
R7271:Map3k1	UTSW	13	111756697	missense	probably benign	0.32
R7290:Map3k1	UTSW	13	111768111	missense	probably damaging	1.00
R7397:Map3k1	UTSW	13	111755208	missense	probably damaging	0.98
R7457:Map3k1	UTSW	13	111756255	missense	probably damaging	0.99
R7827:Map3k1	UTSW	13	111756129	missense	probably benign
R7990:Map3k1	UTSW	13	111756162	missense	probably benign	0.28
R8110:Map3k1	UTSW	13	111755313	missense	probably damaging	0.98
R8119:Map3k1	UTSW	13	111772622	missense	possibly damaging	0.89
R8179:Map3k1	UTSW	13	111749047	missense	probably damaging	1.00
R8317:Map3k1	UTSW	13	111758162	missense	probably damaging	1.00
R8397:Map3k1	UTSW	13	111755604	missense	probably damaging	0.99
X0065:Map3k1	UTSW	13	111757105	missense	probably damaging	1.00
Z1177:Map3k1	UTSW	13	111755946	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AAATCAGTCTTAAGAAGGGTTGC -3'
(R):5'- AATGCCATTTGCTGCCCAC -3'

Sequencing Primer
(F):5'- TACTTGCCTAGCATGGACAAGGTC -3'
(R):5'- CCACGTGGGAGATGGTTTG -3'

Posted On

2018-11-06