Incidental Mutation 'R6900:Olfr728'
ID538500
Institutional Source Beutler Lab
Gene Symbol Olfr728
Ensembl Gene ENSMUSG00000050030
Gene Nameolfactory receptor 728
SynonymsMOR246-1P, GA_x6K02T2PMLR-5831021-5830086
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R6900 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location50133758-50142680 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 50139838 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 267 (V267E)
Ref Sequence ENSEMBL: ENSMUSP00000149796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051563] [ENSMUST00000213163] [ENSMUST00000213685] [ENSMUST00000215327] [ENSMUST00000215451]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051563
AA Change: V267E

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000052079
Gene: ENSMUSG00000050030
AA Change: V267E

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 9.8e-43 PFAM
Pfam:7TM_GPCR_Srx 31 304 9.8e-7 PFAM
Pfam:7TM_GPCR_Srsx 35 297 6.5e-9 PFAM
Pfam:7tm_1 41 287 1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213163
Predicted Effect possibly damaging
Transcript: ENSMUST00000213685
AA Change: V267E

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000215327
Predicted Effect probably benign
Transcript: ENSMUST00000215451
Meta Mutation Damage Score 0.2622 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap10 T C 8: 77,310,862 D579G probably damaging Het
Cc2d2b A G 19: 40,825,074 S1333G probably null Het
Cep250 A G 2: 155,996,270 probably null Het
Chd3 T C 11: 69,354,445 D1149G possibly damaging Het
Dnah7a A G 1: 53,662,351 L215P probably damaging Het
Fbn2 T C 18: 58,076,831 M993V probably benign Het
Ggt5 A T 10: 75,610,537 Q523L possibly damaging Het
Hcn1 A G 13: 117,656,827 N205S probably benign Het
Htr1b A T 9: 81,631,570 I328N probably damaging Het
Itgav T A 2: 83,803,247 F980Y probably damaging Het
Kbtbd2 A G 6: 56,780,023 S243P probably damaging Het
Kcnd2 A G 6: 21,216,588 N97S probably damaging Het
Kif1bp T C 10: 62,559,129 Y578C probably damaging Het
Lars T C 18: 42,234,610 K468E probably benign Het
Map3k1 T C 13: 111,753,816 N1283S probably benign Het
Mapk8ip3 A T 17: 24,909,123 probably null Het
Mroh2b A G 15: 4,908,987 I253V probably benign Het
Nup98 A G 7: 102,185,962 F228S probably damaging Het
Pdzd2 A G 15: 12,374,037 F2004S probably benign Het
Pkhd1 A T 1: 20,534,701 L1130Q probably benign Het
Pparg G T 6: 115,472,988 R286L possibly damaging Het
Ppp1r16a A G 15: 76,691,723 S96G probably damaging Het
Psg29 C T 7: 17,204,932 Q44* probably null Het
Rgs22 A G 15: 36,010,747 F1227S possibly damaging Het
Saxo1 T C 4: 86,445,334 D304G possibly damaging Het
Sec14l1 T C 11: 117,117,223 Y12H probably damaging Het
Sh3bp4 A G 1: 89,145,767 N779S probably benign Het
Sin3a T C 9: 57,107,574 V693A probably damaging Het
Teddm1b G A 1: 153,875,210 C255Y probably benign Het
Ttk T A 9: 83,872,030 S819T probably damaging Het
Zfp362 C T 4: 128,786,015 C273Y probably damaging Het
Other mutations in Olfr728
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01101:Olfr728 APN 14 50140054 missense probably benign 0.06
IGL02080:Olfr728 APN 14 50140122 missense probably damaging 1.00
IGL03187:Olfr728 APN 14 50139800 missense probably damaging 0.98
R1613:Olfr728 UTSW 14 50140294 missense probably damaging 1.00
R1671:Olfr728 UTSW 14 50139833 missense probably damaging 1.00
R1876:Olfr728 UTSW 14 50140172 missense probably damaging 0.99
R2085:Olfr728 UTSW 14 50140123 missense probably damaging 1.00
R2086:Olfr728 UTSW 14 50140123 missense probably damaging 1.00
R2158:Olfr728 UTSW 14 50140123 missense probably damaging 1.00
R2226:Olfr728 UTSW 14 50140619 missense probably damaging 1.00
R2516:Olfr728 UTSW 14 50139983 missense probably benign
R4454:Olfr728 UTSW 14 50140496 missense probably benign 0.00
R4714:Olfr728 UTSW 14 50139979 missense possibly damaging 0.55
R4754:Olfr728 UTSW 14 50140033 missense possibly damaging 0.90
R4754:Olfr728 UTSW 14 50140034 missense probably benign 0.02
R5275:Olfr728 UTSW 14 50140496 missense probably benign 0.35
R5339:Olfr728 UTSW 14 50140302 missense probably damaging 0.96
R6614:Olfr728 UTSW 14 50140364 missense probably damaging 1.00
R6713:Olfr728 UTSW 14 50139724 missense probably benign
R7062:Olfr728 UTSW 14 50140450 missense probably damaging 1.00
R7192:Olfr728 UTSW 14 50140120 missense possibly damaging 0.48
R7528:Olfr728 UTSW 14 50139820 missense possibly damaging 0.93
R7740:Olfr728 UTSW 14 50140346 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TTGGAATCCCCTGGAGAGTC -3'
(R):5'- ACCTTGGCTAACAGTGGTATG -3'

Sequencing Primer
(F):5'- GGAATCCCCTGGAGAGTCTTCATTC -3'
(R):5'- CCTTGGCTAACAGTGGTATGATATC -3'
Posted On2018-11-06