Incidental Mutation 'R6900:Rgs22'
ID538503
Institutional Source Beutler Lab
Gene Symbol Rgs22
Ensembl Gene ENSMUSG00000037627
Gene Nameregulator of G-protein signalling 22
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_001195748; MGI: 3613651

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6900 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location36009479-36140400 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36010747 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 1227 (F1227S)
Ref Sequence ENSEMBL: ENSMUSP00000134259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172831]
Predicted Effect possibly damaging
Transcript: ENSMUST00000172831
AA Change: F1227S

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134259
Gene: ENSMUSG00000037627
AA Change: F1227S

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
low complexity region 62 76 N/A INTRINSIC
low complexity region 173 179 N/A INTRINSIC
low complexity region 376 391 N/A INTRINSIC
RGS 845 973 3.15e-2 SMART
RGS 1014 1134 1.56e-15 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000133703
Gene: ENSMUSG00000037627
AA Change: F216S

DomainStartEndE-ValueType
RGS 4 124 1.56e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (32/32)
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap10 T C 8: 77,310,862 D579G probably damaging Het
Cc2d2b A G 19: 40,825,074 S1333G probably null Het
Cep250 A G 2: 155,996,270 probably null Het
Chd3 T C 11: 69,354,445 D1149G possibly damaging Het
Dnah7a A G 1: 53,662,351 L215P probably damaging Het
Fbn2 T C 18: 58,076,831 M993V probably benign Het
Ggt5 A T 10: 75,610,537 Q523L possibly damaging Het
Hcn1 A G 13: 117,656,827 N205S probably benign Het
Htr1b A T 9: 81,631,570 I328N probably damaging Het
Itgav T A 2: 83,803,247 F980Y probably damaging Het
Kbtbd2 A G 6: 56,780,023 S243P probably damaging Het
Kcnd2 A G 6: 21,216,588 N97S probably damaging Het
Kif1bp T C 10: 62,559,129 Y578C probably damaging Het
Lars T C 18: 42,234,610 K468E probably benign Het
Map3k1 T C 13: 111,753,816 N1283S probably benign Het
Mapk8ip3 A T 17: 24,909,123 probably null Het
Mroh2b A G 15: 4,908,987 I253V probably benign Het
Nup98 A G 7: 102,185,962 F228S probably damaging Het
Olfr728 A T 14: 50,139,838 V267E possibly damaging Het
Pdzd2 A G 15: 12,374,037 F2004S probably benign Het
Pkhd1 A T 1: 20,534,701 L1130Q probably benign Het
Pparg G T 6: 115,472,988 R286L possibly damaging Het
Ppp1r16a A G 15: 76,691,723 S96G probably damaging Het
Psg29 C T 7: 17,204,932 Q44* probably null Het
Saxo1 T C 4: 86,445,334 D304G possibly damaging Het
Sec14l1 T C 11: 117,117,223 Y12H probably damaging Het
Sh3bp4 A G 1: 89,145,767 N779S probably benign Het
Sin3a T C 9: 57,107,574 V693A probably damaging Het
Teddm1b G A 1: 153,875,210 C255Y probably benign Het
Ttk T A 9: 83,872,030 S819T probably damaging Het
Zfp362 C T 4: 128,786,015 C273Y probably damaging Het
Other mutations in Rgs22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Rgs22 APN 15 36099931 missense possibly damaging 0.93
IGL00594:Rgs22 APN 15 36083631 missense probably benign 0.00
IGL01464:Rgs22 APN 15 36083641 missense possibly damaging 0.90
IGL01686:Rgs22 APN 15 36103835 missense probably benign 0.00
IGL01761:Rgs22 APN 15 36103751 missense probably damaging 0.99
IGL02045:Rgs22 APN 15 36013154 missense probably benign 0.33
IGL02378:Rgs22 APN 15 36103805 missense probably benign 0.00
IGL02490:Rgs22 APN 15 36054847 missense probably damaging 1.00
IGL03219:Rgs22 APN 15 36107048 missense probably damaging 1.00
IGL03229:Rgs22 APN 15 36015779 splice site probably benign
IGL03328:Rgs22 APN 15 36043204 critical splice donor site probably null
3-1:Rgs22 UTSW 15 36100036 missense possibly damaging 0.48
R0254:Rgs22 UTSW 15 36104552 missense probably damaging 0.99
R0463:Rgs22 UTSW 15 36092938 missense probably damaging 1.00
R0467:Rgs22 UTSW 15 36099795 nonsense probably null
R0486:Rgs22 UTSW 15 36092882 missense probably damaging 0.98
R0554:Rgs22 UTSW 15 36054709 missense probably benign 0.10
R0602:Rgs22 UTSW 15 36139872 splice site probably benign
R0906:Rgs22 UTSW 15 36103902 intron probably benign
R1159:Rgs22 UTSW 15 36040693 missense probably damaging 1.00
R1300:Rgs22 UTSW 15 36101762 missense probably benign 0.43
R1439:Rgs22 UTSW 15 36025793 splice site probably benign
R1491:Rgs22 UTSW 15 36092901 missense probably damaging 0.98
R1502:Rgs22 UTSW 15 36080851 missense probably damaging 1.00
R1514:Rgs22 UTSW 15 36013100 missense probably benign 0.00
R1538:Rgs22 UTSW 15 36048776 missense probably damaging 1.00
R1784:Rgs22 UTSW 15 36087436 missense probably damaging 1.00
R1938:Rgs22 UTSW 15 36101804 missense probably benign 0.00
R1972:Rgs22 UTSW 15 36103836 missense probably benign 0.01
R2109:Rgs22 UTSW 15 36099734 nonsense probably null
R2208:Rgs22 UTSW 15 36050232 missense probably benign 0.01
R3696:Rgs22 UTSW 15 36099892 missense probably benign 0.00
R3697:Rgs22 UTSW 15 36099892 missense probably benign 0.00
R3698:Rgs22 UTSW 15 36099892 missense probably benign 0.00
R3879:Rgs22 UTSW 15 36106905 missense possibly damaging 0.52
R4080:Rgs22 UTSW 15 36107076 missense probably damaging 1.00
R4363:Rgs22 UTSW 15 36103874 missense probably damaging 0.99
R4591:Rgs22 UTSW 15 36100136 missense probably benign 0.01
R4673:Rgs22 UTSW 15 36099933 missense probably benign 0.04
R4829:Rgs22 UTSW 15 36103888 missense probably damaging 1.00
R4831:Rgs22 UTSW 15 36050148 missense probably benign 0.00
R4865:Rgs22 UTSW 15 36100212 missense probably damaging 1.00
R4907:Rgs22 UTSW 15 36087424 missense possibly damaging 0.61
R4944:Rgs22 UTSW 15 36025942 missense possibly damaging 0.83
R4975:Rgs22 UTSW 15 36054876 nonsense probably null
R5056:Rgs22 UTSW 15 36050245 unclassified probably null
R5126:Rgs22 UTSW 15 36040644 missense probably damaging 0.96
R5138:Rgs22 UTSW 15 36099788 missense probably benign 0.04
R5444:Rgs22 UTSW 15 36015627 missense possibly damaging 0.83
R5507:Rgs22 UTSW 15 36099652 missense probably damaging 0.99
R5640:Rgs22 UTSW 15 36106955 missense probably benign 0.00
R5969:Rgs22 UTSW 15 36015636 missense probably benign 0.00
R6005:Rgs22 UTSW 15 36010567 missense probably benign 0.39
R6053:Rgs22 UTSW 15 36100007 missense probably benign 0.04
R6134:Rgs22 UTSW 15 36107048 missense probably damaging 1.00
R6230:Rgs22 UTSW 15 36100030 missense probably benign 0.02
R6295:Rgs22 UTSW 15 36087374 missense probably benign 0.00
R6352:Rgs22 UTSW 15 36092921 missense probably damaging 1.00
R6809:Rgs22 UTSW 15 36048764 missense probably damaging 1.00
R6947:Rgs22 UTSW 15 36103890 critical splice acceptor site probably null
R7102:Rgs22 UTSW 15 36122313 missense probably damaging 1.00
R7126:Rgs22 UTSW 15 36103808 missense probably damaging 0.97
R7263:Rgs22 UTSW 15 36015643 missense possibly damaging 0.86
R7623:Rgs22 UTSW 15 36040710 missense probably benign 0.08
R7732:Rgs22 UTSW 15 36025981 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGAAGGCAGGCAATCAC -3'
(R):5'- GCTGTTTCTTTCTTAAGGGCAATC -3'

Sequencing Primer
(F):5'- CATTCTTCTTCAGAGACAGAGCGG -3'
(R):5'- CTTTCTTAAGGGCAATCTGGGAAG -3'
Posted On2018-11-06