Incidental Mutation 'R6901:Tgm3'
ID538510
Institutional Source Beutler Lab
Gene Symbol Tgm3
Ensembl Gene ENSMUSG00000027401
Gene Nametransglutaminase 3, E polypeptide
SynonymsTG E
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6901 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location130012349-130050399 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 130041970 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 516 (T516M)
Ref Sequence ENSEMBL: ENSMUSP00000105928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110299]
Predicted Effect possibly damaging
Transcript: ENSMUST00000110299
AA Change: T516M

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105928
Gene: ENSMUSG00000027401
AA Change: T516M

DomainStartEndE-ValueType
Pfam:Transglut_N 5 118 8.3e-33 PFAM
TGc 265 357 6.4e-39 SMART
Pfam:Transglut_C 483 588 3.9e-26 PFAM
Pfam:Transglut_C 595 693 4.9e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transglutaminases are enzymes that catalyze the crosslinking of proteins by epsilon-gamma glutamyl lysine isopeptide bonds. While the primary structure of transglutaminases is not conserved, they all have the same amino acid sequence at their active sites and their activity is calcium-dependent. The protein encoded by this gene consists of two polypeptide chains activated from a single precursor protein by proteolysis. The encoded protein is involved the later stages of cell envelope formation in the epidermis and hair follicle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU or null mutation exhibit rough-looking, curly hair. Null mutants display delayed skin barrier formation, loss of vibrissae, and brittle hairs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd5 T A 9: 122,368,155 S136T probably benign Het
Anxa10 T C 8: 62,096,782 T10A probably damaging Het
Ap3b1 A G 13: 94,418,142 E262G probably benign Het
Ap3b2 T C 7: 81,484,912 probably null Het
Arhgef40 A G 14: 51,997,368 T1043A probably damaging Het
Arhgef5 T A 6: 43,273,298 S328T probably benign Het
Arid4a A G 12: 71,067,137 K166R probably damaging Het
Cdh12 A G 15: 21,583,786 I571V probably benign Het
Cdh4 G A 2: 179,860,194 V316I probably benign Het
Cebpg A T 7: 35,050,777 H20Q probably benign Het
Ces4a G A 8: 105,146,698 V392I probably benign Het
CN725425 C A 15: 91,240,763 P169T possibly damaging Het
Cyp2c54 A G 19: 40,070,259 F243S probably damaging Het
Dkk2 T A 3: 132,175,126 probably null Het
Dync2h1 A G 9: 7,131,855 Y1651H probably damaging Het
Dyrk1b T A 7: 28,185,117 L346Q probably damaging Het
Ephx4 T C 5: 107,413,561 V85A probably benign Het
Etv6 A G 6: 134,266,458 E392G probably benign Het
Fli1 T A 9: 32,429,925 N202I probably benign Het
Gm10093 A G 17: 78,492,660 E360G probably benign Het
Gpc6 G T 14: 117,951,217 R421L possibly damaging Het
Gse1 A G 8: 120,229,822 probably benign Het
Hnrnpab T C 11: 51,601,848 probably benign Het
Hyal4 A G 6: 24,756,191 E136G probably damaging Het
Kcna3 C T 3: 107,036,568 A49V probably benign Het
Krt42 C T 11: 100,269,716 M52I probably benign Het
Lyrm4 A T 13: 36,117,124 Y13N probably damaging Het
Map2 C T 1: 66,421,773 S1576L possibly damaging Het
Map3k12 G T 15: 102,500,629 P817Q possibly damaging Het
Map3k12 G T 15: 102,500,630 P817T possibly damaging Het
Masp1 T C 16: 23,513,834 K84E probably damaging Het
Mki67 A T 7: 135,708,760 probably null Het
Mrap C G 16: 90,749,305 S94C probably damaging Het
Mybpc2 C A 7: 44,505,355 C986F probably damaging Het
Nbea A C 3: 56,019,415 M789R probably damaging Het
Olfr1416 G T 1: 92,480,605 N5K probably damaging Het
Olfr694 T C 7: 106,689,189 I181V probably benign Het
Pde4a A G 9: 21,204,970 N475S probably benign Het
Pex7 C T 10: 19,860,994 V297I probably benign Het
Pkd1l3 A T 8: 109,614,614 H33L unknown Het
Prl8a6 A T 13: 27,437,047 Y67N possibly damaging Het
Rcor1 A T 12: 111,108,888 E383V probably damaging Het
Slc22a27 A T 19: 7,926,579 S64R probably damaging Het
Snx7 G A 3: 117,829,636 Q292* probably null Het
Trim9 T C 12: 70,346,639 E177G probably damaging Het
Ttc26 G A 6: 38,401,144 R297H possibly damaging Het
Ttc28 C A 5: 111,277,025 T1541N possibly damaging Het
Ttc8 T A 12: 98,961,476 L202H probably damaging Het
Ttll13 T C 7: 80,250,182 Y90H probably damaging Het
Uba1y T G Y: 825,496 I286S probably benign Het
Ubxn11 G A 4: 134,126,264 A125T probably damaging Het
Vmn1r48 A G 6: 90,036,568 Y92H possibly damaging Het
Vmn1r74 T C 7: 11,847,441 F223L probably benign Het
Vwa5b1 G A 4: 138,586,569 T696I probably benign Het
Zfp266 G T 9: 20,499,599 Y427* probably null Het
Zfp362 C T 4: 128,786,015 C273Y probably damaging Het
Zfp385c T C 11: 100,632,759 N123S probably benign Het
Zfp936 T A 7: 43,190,043 H311Q probably damaging Het
Other mutations in Tgm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Tgm3 APN 2 130038413 missense probably damaging 1.00
IGL00924:Tgm3 APN 2 130038374 missense probably damaging 1.00
IGL01469:Tgm3 APN 2 130024494 missense probably damaging 1.00
IGL01722:Tgm3 APN 2 130044568 missense probably damaging 0.99
IGL01787:Tgm3 APN 2 130047740 missense possibly damaging 0.85
IGL02269:Tgm3 APN 2 130024518 missense probably benign 0.02
IGL02437:Tgm3 APN 2 130030041 splice site probably null
IGL02449:Tgm3 APN 2 130038609 critical splice donor site probably null
IGL02992:Tgm3 APN 2 130041979 missense probably damaging 1.00
tortellini UTSW 2 130024585 critical splice donor site probably benign
ANU74:Tgm3 UTSW 2 130048390 missense probably damaging 1.00
R0523:Tgm3 UTSW 2 130044662 critical splice donor site probably null
R0833:Tgm3 UTSW 2 130026682 splice site probably benign
R0834:Tgm3 UTSW 2 130026757 missense probably benign 0.00
R0836:Tgm3 UTSW 2 130026682 splice site probably benign
R0940:Tgm3 UTSW 2 130012406 missense probably benign 0.00
R1354:Tgm3 UTSW 2 130041898 missense probably benign
R1642:Tgm3 UTSW 2 130047782 missense probably damaging 1.00
R1670:Tgm3 UTSW 2 130041768 nonsense probably null
R1715:Tgm3 UTSW 2 130026814 critical splice donor site probably null
R1944:Tgm3 UTSW 2 130029969 missense probably damaging 0.99
R2104:Tgm3 UTSW 2 130037483 missense probably benign 0.39
R3416:Tgm3 UTSW 2 130047772 missense possibly damaging 0.84
R3417:Tgm3 UTSW 2 130047772 missense possibly damaging 0.84
R4231:Tgm3 UTSW 2 130044589 nonsense probably null
R4296:Tgm3 UTSW 2 130038413 missense possibly damaging 0.77
R4794:Tgm3 UTSW 2 130041955 missense probably benign 0.00
R4948:Tgm3 UTSW 2 130048320 missense probably benign 0.00
R5034:Tgm3 UTSW 2 130037484 missense possibly damaging 0.95
R5144:Tgm3 UTSW 2 130048282 missense possibly damaging 0.95
R5786:Tgm3 UTSW 2 130026784 nonsense probably null
R6030:Tgm3 UTSW 2 130042000 missense probably damaging 1.00
R6030:Tgm3 UTSW 2 130042000 missense probably damaging 1.00
R6182:Tgm3 UTSW 2 130025301 nonsense probably null
R6219:Tgm3 UTSW 2 130038610 critical splice donor site probably null
R6969:Tgm3 UTSW 2 130042029 missense probably benign 0.06
R6980:Tgm3 UTSW 2 130026777 missense probably benign 0.17
R7282:Tgm3 UTSW 2 130024561 missense probably benign 0.00
R7317:Tgm3 UTSW 2 130048291 missense probably benign 0.09
R7513:Tgm3 UTSW 2 130024404 missense probably benign 0.00
R7517:Tgm3 UTSW 2 130041764 missense probably benign 0.01
R7793:Tgm3 UTSW 2 130012410 critical splice donor site probably null
R7822:Tgm3 UTSW 2 130041899 missense probably benign 0.00
R7955:Tgm3 UTSW 2 130038480 missense probably benign
X0065:Tgm3 UTSW 2 130024510 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AATGCACAGGTTCCAGTGAG -3'
(R):5'- AAGCAGTAGGATCCCATCAGTG -3'

Sequencing Primer
(F):5'- CAAGTGCACCAAAAGGCTTTG -3'
(R):5'- CCATCAGTGAGCAACTCTTTTGGG -3'
Posted On2018-11-06