Incidental Mutation 'R6901:Hyal4'
ID 538521
Institutional Source Beutler Lab
Gene Symbol Hyal4
Ensembl Gene ENSMUSG00000029680
Gene Name hyaluronoglucosaminidase 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6901 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 24748329-24767662 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 24756191 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 136 (E136G)
Ref Sequence ENSEMBL: ENSMUSP00000031691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031691]
AlphaFold Q05A56
Predicted Effect probably damaging
Transcript: ENSMUST00000031691
AA Change: E136G

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031691
Gene: ENSMUSG00000029680
AA Change: E136G

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:Glyco_hydro_56 41 373 3e-137 PFAM
EGF 375 447 2.81e0 SMART
low complexity region 453 473 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is similar in structure to hyaluronidases. Hyaluronidases intracellularly degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. Hyaluronan is thought to be involved in cell proliferation, migration and differentiation. However, this protein has not yet been shown to have hyaluronidase activity. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd5 T A 9: 122,368,155 S136T probably benign Het
Anxa10 T C 8: 62,096,782 T10A probably damaging Het
Ap3b1 A G 13: 94,418,142 E262G probably benign Het
Ap3b2 T C 7: 81,484,912 probably null Het
Arhgef40 A G 14: 51,997,368 T1043A probably damaging Het
Arhgef5 T A 6: 43,273,298 S328T probably benign Het
Arid4a A G 12: 71,067,137 K166R probably damaging Het
Cdh12 A G 15: 21,583,786 I571V probably benign Het
Cdh4 G A 2: 179,860,194 V316I probably benign Het
Cebpg A T 7: 35,050,777 H20Q probably benign Het
Ces4a G A 8: 105,146,698 V392I probably benign Het
CN725425 C A 15: 91,240,763 P169T possibly damaging Het
Cyp2c54 A G 19: 40,070,259 F243S probably damaging Het
Dkk2 T A 3: 132,175,126 probably null Het
Dync2h1 A G 9: 7,131,855 Y1651H probably damaging Het
Dyrk1b T A 7: 28,185,117 L346Q probably damaging Het
Ephx4 T C 5: 107,413,561 V85A probably benign Het
Etv6 A G 6: 134,266,458 E392G probably benign Het
Fli1 T A 9: 32,429,925 N202I probably benign Het
Gm10093 A G 17: 78,492,660 E360G probably benign Het
Gpc6 G T 14: 117,951,217 R421L possibly damaging Het
Gse1 A G 8: 120,229,822 probably benign Het
Hnrnpab T C 11: 51,601,848 probably benign Het
Kcna3 C T 3: 107,036,568 A49V probably benign Het
Krt42 C T 11: 100,269,716 M52I probably benign Het
Lyrm4 A T 13: 36,117,124 Y13N probably damaging Het
Map2 C T 1: 66,421,773 S1576L possibly damaging Het
Map3k12 G T 15: 102,500,629 P817Q possibly damaging Het
Map3k12 G T 15: 102,500,630 P817T possibly damaging Het
Masp1 T C 16: 23,513,834 K84E probably damaging Het
Mki67 A T 7: 135,708,760 probably null Het
Mrap C G 16: 90,749,305 S94C probably damaging Het
Mybpc2 C A 7: 44,505,355 C986F probably damaging Het
Nbea A C 3: 56,019,415 M789R probably damaging Het
Olfr1416 G T 1: 92,480,605 N5K probably damaging Het
Olfr694 T C 7: 106,689,189 I181V probably benign Het
Pde4a A G 9: 21,204,970 N475S probably benign Het
Pex7 C T 10: 19,860,994 V297I probably benign Het
Pkd1l3 A T 8: 109,614,614 H33L unknown Het
Prl8a6 A T 13: 27,437,047 Y67N possibly damaging Het
Rcor1 A T 12: 111,108,888 E383V probably damaging Het
Slc22a27 A T 19: 7,926,579 S64R probably damaging Het
Snx7 G A 3: 117,829,636 Q292* probably null Het
Tgm3 C T 2: 130,041,970 T516M possibly damaging Het
Trim9 T C 12: 70,346,639 E177G probably damaging Het
Ttc26 G A 6: 38,401,144 R297H possibly damaging Het
Ttc28 C A 5: 111,277,025 T1541N possibly damaging Het
Ttc8 T A 12: 98,961,476 L202H probably damaging Het
Ttll13 T C 7: 80,250,182 Y90H probably damaging Het
Uba1y T G Y: 825,496 I286S probably benign Het
Ubxn11 G A 4: 134,126,264 A125T probably damaging Het
Vmn1r48 A G 6: 90,036,568 Y92H possibly damaging Het
Vmn1r74 T C 7: 11,847,441 F223L probably benign Het
Vwa5b1 G A 4: 138,586,569 T696I probably benign Het
Zfp266 G T 9: 20,499,599 Y427* probably null Het
Zfp362 C T 4: 128,786,015 C273Y probably damaging Het
Zfp385c T C 11: 100,632,759 N123S probably benign Het
Zfp936 T A 7: 43,190,043 H311Q probably damaging Het
Other mutations in Hyal4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Hyal4 APN 6 24755872 missense probably benign 0.03
IGL01791:Hyal4 APN 6 24763895 splice site probably benign
IGL02434:Hyal4 APN 6 24763858 nonsense probably null
IGL02523:Hyal4 APN 6 24765969 missense probably damaging 0.96
IGL03114:Hyal4 APN 6 24755965 missense probably benign 0.00
IGL02835:Hyal4 UTSW 6 24765715 missense probably benign 0.00
PIT4494001:Hyal4 UTSW 6 24755834 missense probably benign 0.05
R0196:Hyal4 UTSW 6 24756221 missense probably damaging 1.00
R0323:Hyal4 UTSW 6 24756194 missense probably benign 0.30
R0398:Hyal4 UTSW 6 24756671 missense probably damaging 0.97
R0946:Hyal4 UTSW 6 24755913 nonsense probably null
R0961:Hyal4 UTSW 6 24755746 utr 5 prime probably benign
R1906:Hyal4 UTSW 6 24756111 missense probably damaging 1.00
R1998:Hyal4 UTSW 6 24756311 missense probably benign 0.00
R2085:Hyal4 UTSW 6 24755750 start gained probably benign
R2483:Hyal4 UTSW 6 24765738 missense probably damaging 0.96
R3622:Hyal4 UTSW 6 24765738 missense probably damaging 0.96
R3623:Hyal4 UTSW 6 24765738 missense probably damaging 0.96
R3624:Hyal4 UTSW 6 24765738 missense probably damaging 0.96
R3712:Hyal4 UTSW 6 24756514 missense probably damaging 1.00
R4031:Hyal4 UTSW 6 24756224 missense probably damaging 1.00
R5762:Hyal4 UTSW 6 24765862 missense possibly damaging 0.93
R6177:Hyal4 UTSW 6 24766090 nonsense probably null
R6442:Hyal4 UTSW 6 24765850 missense probably benign 0.08
R6494:Hyal4 UTSW 6 24765746 missense possibly damaging 0.79
R7565:Hyal4 UTSW 6 24765934 missense possibly damaging 0.77
R7973:Hyal4 UTSW 6 24755786 start codon destroyed probably null 0.99
R7977:Hyal4 UTSW 6 24763866 missense probably damaging 0.99
R7987:Hyal4 UTSW 6 24763866 missense probably damaging 0.99
R8020:Hyal4 UTSW 6 24755996 missense probably benign 0.14
R8676:Hyal4 UTSW 6 24755827 missense probably damaging 0.99
R9331:Hyal4 UTSW 6 24765867 missense probably damaging 1.00
Z1176:Hyal4 UTSW 6 24756628 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCCAACAGACCTGTGTTTG -3'
(R):5'- TTCTCAAAAGTTGCCTTGGCTG -3'

Sequencing Primer
(F):5'- TCAGATGGTTGGAAGCCCTC -3'
(R):5'- GGCTGAATATTCAATATCAGCAGCAG -3'
Posted On 2018-11-06