Incidental Mutation 'R6901:Arhgef5'
ID 538523
Institutional Source Beutler Lab
Gene Symbol Arhgef5
Ensembl Gene ENSMUSG00000033542
Gene Name Rho guanine nucleotide exchange factor (GEF) 5
Synonyms 2210412D05Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6901 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 43265582-43289320 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 43273298 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 328 (S328T)
Ref Sequence ENSEMBL: ENSMUSP00000031750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031750]
AlphaFold E9Q7D5
Predicted Effect probably benign
Transcript: ENSMUST00000031750
AA Change: S328T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: S328T

DomainStartEndE-ValueType
Pfam:ARHGEF5_35 1 477 3.1e-220 PFAM
low complexity region 509 531 N/A INTRINSIC
low complexity region 812 825 N/A INTRINSIC
low complexity region 827 851 N/A INTRINSIC
RhoGEF 1162 1341 2.97e-57 SMART
PH 1375 1488 1.11e-6 SMART
SH3 1497 1554 6.39e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182924
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd5 T A 9: 122,368,155 S136T probably benign Het
Anxa10 T C 8: 62,096,782 T10A probably damaging Het
Ap3b1 A G 13: 94,418,142 E262G probably benign Het
Ap3b2 T C 7: 81,484,912 probably null Het
Arhgef40 A G 14: 51,997,368 T1043A probably damaging Het
Arid4a A G 12: 71,067,137 K166R probably damaging Het
Cdh12 A G 15: 21,583,786 I571V probably benign Het
Cdh4 G A 2: 179,860,194 V316I probably benign Het
Cebpg A T 7: 35,050,777 H20Q probably benign Het
Ces4a G A 8: 105,146,698 V392I probably benign Het
CN725425 C A 15: 91,240,763 P169T possibly damaging Het
Cyp2c54 A G 19: 40,070,259 F243S probably damaging Het
Dkk2 T A 3: 132,175,126 probably null Het
Dync2h1 A G 9: 7,131,855 Y1651H probably damaging Het
Dyrk1b T A 7: 28,185,117 L346Q probably damaging Het
Ephx4 T C 5: 107,413,561 V85A probably benign Het
Etv6 A G 6: 134,266,458 E392G probably benign Het
Fli1 T A 9: 32,429,925 N202I probably benign Het
Gm10093 A G 17: 78,492,660 E360G probably benign Het
Gpc6 G T 14: 117,951,217 R421L possibly damaging Het
Gse1 A G 8: 120,229,822 probably benign Het
Hnrnpab T C 11: 51,601,848 probably benign Het
Hyal4 A G 6: 24,756,191 E136G probably damaging Het
Kcna3 C T 3: 107,036,568 A49V probably benign Het
Krt42 C T 11: 100,269,716 M52I probably benign Het
Lyrm4 A T 13: 36,117,124 Y13N probably damaging Het
Map2 C T 1: 66,421,773 S1576L possibly damaging Het
Map3k12 G T 15: 102,500,629 P817Q possibly damaging Het
Map3k12 G T 15: 102,500,630 P817T possibly damaging Het
Masp1 T C 16: 23,513,834 K84E probably damaging Het
Mki67 A T 7: 135,708,760 probably null Het
Mrap C G 16: 90,749,305 S94C probably damaging Het
Mybpc2 C A 7: 44,505,355 C986F probably damaging Het
Nbea A C 3: 56,019,415 M789R probably damaging Het
Olfr1416 G T 1: 92,480,605 N5K probably damaging Het
Olfr694 T C 7: 106,689,189 I181V probably benign Het
Pde4a A G 9: 21,204,970 N475S probably benign Het
Pex7 C T 10: 19,860,994 V297I probably benign Het
Pkd1l3 A T 8: 109,614,614 H33L unknown Het
Prl8a6 A T 13: 27,437,047 Y67N possibly damaging Het
Rcor1 A T 12: 111,108,888 E383V probably damaging Het
Slc22a27 A T 19: 7,926,579 S64R probably damaging Het
Snx7 G A 3: 117,829,636 Q292* probably null Het
Tgm3 C T 2: 130,041,970 T516M possibly damaging Het
Trim9 T C 12: 70,346,639 E177G probably damaging Het
Ttc26 G A 6: 38,401,144 R297H possibly damaging Het
Ttc28 C A 5: 111,277,025 T1541N possibly damaging Het
Ttc8 T A 12: 98,961,476 L202H probably damaging Het
Ttll13 T C 7: 80,250,182 Y90H probably damaging Het
Uba1y T G Y: 825,496 I286S probably benign Het
Ubxn11 G A 4: 134,126,264 A125T probably damaging Het
Vmn1r48 A G 6: 90,036,568 Y92H possibly damaging Het
Vmn1r74 T C 7: 11,847,441 F223L probably benign Het
Vwa5b1 G A 4: 138,586,569 T696I probably benign Het
Zfp266 G T 9: 20,499,599 Y427* probably null Het
Zfp362 C T 4: 128,786,015 C273Y probably damaging Het
Zfp385c T C 11: 100,632,759 N123S probably benign Het
Zfp936 T A 7: 43,190,043 H311Q probably damaging Het
Other mutations in Arhgef5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Arhgef5 APN 6 43280269 nonsense probably null
IGL01341:Arhgef5 APN 6 43283991 missense probably damaging 1.00
IGL01576:Arhgef5 APN 6 43274028 missense probably benign 0.38
IGL01761:Arhgef5 APN 6 43274604 missense probably benign 0.00
IGL02104:Arhgef5 APN 6 43272411 missense probably damaging 0.99
IGL02208:Arhgef5 APN 6 43275130 missense probably benign 0.11
IGL02487:Arhgef5 APN 6 43283982 missense probably damaging 1.00
IGL02650:Arhgef5 APN 6 43272935 nonsense probably null
IGL03292:Arhgef5 APN 6 43280246 missense probably damaging 1.00
IGL03334:Arhgef5 APN 6 43274000 missense possibly damaging 0.47
IGL03341:Arhgef5 APN 6 43280651 missense probably damaging 0.99
R0047:Arhgef5 UTSW 6 43265621 splice site probably null
R0206:Arhgef5 UTSW 6 43273341 missense probably damaging 1.00
R0208:Arhgef5 UTSW 6 43273341 missense probably damaging 1.00
R0698:Arhgef5 UTSW 6 43273341 missense probably damaging 1.00
R1145:Arhgef5 UTSW 6 43273088 missense possibly damaging 0.92
R1145:Arhgef5 UTSW 6 43273088 missense possibly damaging 0.92
R1168:Arhgef5 UTSW 6 43273396 missense probably benign 0.00
R1355:Arhgef5 UTSW 6 43283912 missense probably damaging 1.00
R1370:Arhgef5 UTSW 6 43283912 missense probably damaging 1.00
R1481:Arhgef5 UTSW 6 43274634 missense probably damaging 0.99
R1529:Arhgef5 UTSW 6 43279515 missense probably damaging 0.96
R1532:Arhgef5 UTSW 6 43273403 missense probably benign
R1663:Arhgef5 UTSW 6 43276965 missense probably damaging 1.00
R1742:Arhgef5 UTSW 6 43280199 missense probably damaging 1.00
R1852:Arhgef5 UTSW 6 43275185 missense probably benign 0.00
R1869:Arhgef5 UTSW 6 43288682 missense probably damaging 1.00
R1880:Arhgef5 UTSW 6 43273088 missense possibly damaging 0.92
R2146:Arhgef5 UTSW 6 43283318 missense probably damaging 1.00
R2169:Arhgef5 UTSW 6 43274420 missense probably benign 0.11
R3412:Arhgef5 UTSW 6 43273790 missense probably benign
R4205:Arhgef5 UTSW 6 43273832 missense possibly damaging 0.76
R4226:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4227:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4304:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4308:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4457:Arhgef5 UTSW 6 43274093 missense probably damaging 1.00
R4469:Arhgef5 UTSW 6 43275099 missense probably benign
R4636:Arhgef5 UTSW 6 43274942 missense probably benign 0.11
R4791:Arhgef5 UTSW 6 43283183 missense probably damaging 1.00
R4818:Arhgef5 UTSW 6 43273550 missense probably benign 0.00
R4910:Arhgef5 UTSW 6 43272828 missense probably benign 0.01
R4911:Arhgef5 UTSW 6 43272828 missense probably benign 0.01
R5127:Arhgef5 UTSW 6 43273214 missense probably damaging 0.99
R5209:Arhgef5 UTSW 6 43273700 missense probably benign 0.01
R5245:Arhgef5 UTSW 6 43265680 start gained probably benign
R5251:Arhgef5 UTSW 6 43272881 missense possibly damaging 0.76
R5513:Arhgef5 UTSW 6 43272339 missense probably damaging 0.96
R5613:Arhgef5 UTSW 6 43274063 missense probably benign 0.01
R5616:Arhgef5 UTSW 6 43275940 missense probably benign 0.20
R5817:Arhgef5 UTSW 6 43275104 missense probably benign 0.15
R6024:Arhgef5 UTSW 6 43275134 missense probably benign 0.00
R6735:Arhgef5 UTSW 6 43275032 missense probably benign 0.01
R6825:Arhgef5 UTSW 6 43274961 missense probably damaging 0.99
R6831:Arhgef5 UTSW 6 43280999 missense probably damaging 1.00
R6932:Arhgef5 UTSW 6 43274417 missense possibly damaging 0.94
R6968:Arhgef5 UTSW 6 43275342 missense probably benign 0.00
R7018:Arhgef5 UTSW 6 43288731 missense probably damaging 1.00
R7180:Arhgef5 UTSW 6 43275208 missense possibly damaging 0.87
R7201:Arhgef5 UTSW 6 43273232 nonsense probably null
R7358:Arhgef5 UTSW 6 43279573 missense probably damaging 1.00
R7359:Arhgef5 UTSW 6 43280282 missense probably damaging 1.00
R7468:Arhgef5 UTSW 6 43280671 nonsense probably null
R7503:Arhgef5 UTSW 6 43273999 missense probably benign 0.15
R7699:Arhgef5 UTSW 6 43274757 missense probably benign 0.11
R7700:Arhgef5 UTSW 6 43274757 missense probably benign 0.11
R7737:Arhgef5 UTSW 6 43273794 missense possibly damaging 0.84
R7847:Arhgef5 UTSW 6 43275135 nonsense probably null
R7950:Arhgef5 UTSW 6 43273925 missense possibly damaging 0.76
R8161:Arhgef5 UTSW 6 43283951 missense probably damaging 1.00
R8178:Arhgef5 UTSW 6 43275185 missense probably benign 0.00
R8203:Arhgef5 UTSW 6 43280645 missense probably damaging 1.00
R8318:Arhgef5 UTSW 6 43275999 critical splice donor site probably null
R8857:Arhgef5 UTSW 6 43287624 missense probably damaging 1.00
R9499:Arhgef5 UTSW 6 43284006 missense
R9610:Arhgef5 UTSW 6 43280956 missense probably damaging 0.99
R9611:Arhgef5 UTSW 6 43280956 missense probably damaging 0.99
R9623:Arhgef5 UTSW 6 43274802 missense possibly damaging 0.86
R9685:Arhgef5 UTSW 6 43273593 missense probably benign 0.11
RF023:Arhgef5 UTSW 6 43279473 missense probably damaging 1.00
X0028:Arhgef5 UTSW 6 43273701 missense probably benign 0.03
X0065:Arhgef5 UTSW 6 43272408 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAATCTCAGGAAGCCCAGGG -3'
(R):5'- CTTGGACCCTGTCACCTGAG -3'

Sequencing Primer
(F):5'- AACTCTGAACGAAGGCATTTG -3'
(R):5'- GGACCCTGTCACCTGAGTCTAC -3'
Posted On 2018-11-06