Mutagenetix > Incidental Mutations

Incidental Mutation 'R6901:Ap3b2'

538532

Institutional Source

Beutler Lab

Gene Symbol

Ap3b2

Ensembl Gene

ENSMUSG00000062444

Gene Name

adaptor-related protein complex 3, beta 2 subunit

Synonyms

beta3B, Naptb

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.107) question?

Stock #

R6901 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

81460399-81493925 bp(-) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

T to C at 81484912 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000146497 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082090] [ENSMUST00000152355]

Predicted Effect

probably null
Transcript: ENSMUST00000082090

SMART Domains

Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	34	590	8.2e-182	PFAM
low complexity region	689	782	N/A	INTRINSIC
AP3B1_C	801	947	4.58e-75	SMART
Blast:B2	971	1080	2e-12	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000152355

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption does not alter pigmentation, but causes hyperactivity and tonic-clonic seizures and mice homozygous for a knock-out allele were found to have significantly reduced synaptic zinc levels throughout the brain, with the largest reduction observed in the CA1 stratum oriens. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd5	T	A	9: 122,368,155	S136T	probably benign	Het
Anxa10	T	C	8: 62,096,782	T10A	probably damaging	Het
Ap3b1	A	G	13: 94,418,142	E262G	probably benign	Het
Arhgef40	A	G	14: 51,997,368	T1043A	probably damaging	Het
Arhgef5	T	A	6: 43,273,298	S328T	probably benign	Het
Arid4a	A	G	12: 71,067,137	K166R	probably damaging	Het
Cdh12	A	G	15: 21,583,786	I571V	probably benign	Het
Cdh4	G	A	2: 179,860,194	V316I	probably benign	Het
Cebpg	A	T	7: 35,050,777	H20Q	probably benign	Het
Ces4a	G	A	8: 105,146,698	V392I	probably benign	Het
CN725425	C	A	15: 91,240,763	P169T	possibly damaging	Het
Cyp2c54	A	G	19: 40,070,259	F243S	probably damaging	Het
Dkk2	T	A	3: 132,175,126		probably null	Het
Dync2h1	A	G	9: 7,131,855	Y1651H	probably damaging	Het
Dyrk1b	T	A	7: 28,185,117	L346Q	probably damaging	Het
Ephx4	T	C	5: 107,413,561	V85A	probably benign	Het
Etv6	A	G	6: 134,266,458	E392G	probably benign	Het
Fli1	T	A	9: 32,429,925	N202I	probably benign	Het
Gm10093	A	G	17: 78,492,660	E360G	probably benign	Het
Gpc6	G	T	14: 117,951,217	R421L	possibly damaging	Het
Gse1	A	G	8: 120,229,822		probably benign	Het
Hnrnpab	T	C	11: 51,601,848		probably benign	Het
Hyal4	A	G	6: 24,756,191	E136G	probably damaging	Het
Kcna3	C	T	3: 107,036,568	A49V	probably benign	Het
Krt42	C	T	11: 100,269,716	M52I	probably benign	Het
Lyrm4	A	T	13: 36,117,124	Y13N	probably damaging	Het
Map2	C	T	1: 66,421,773	S1576L	possibly damaging	Het
Map3k12	G	T	15: 102,500,629	P817Q	possibly damaging	Het
Map3k12	G	T	15: 102,500,630	P817T	possibly damaging	Het
Masp1	T	C	16: 23,513,834	K84E	probably damaging	Het
Mki67	A	T	7: 135,708,760		probably null	Het
Mrap	C	G	16: 90,749,305	S94C	probably damaging	Het
Mybpc2	C	A	7: 44,505,355	C986F	probably damaging	Het
Nbea	A	C	3: 56,019,415	M789R	probably damaging	Het
Olfr1416	G	T	1: 92,480,605	N5K	probably damaging	Het
Olfr694	T	C	7: 106,689,189	I181V	probably benign	Het
Pde4a	A	G	9: 21,204,970	N475S	probably benign	Het
Pex7	C	T	10: 19,860,994	V297I	probably benign	Het
Pkd1l3	A	T	8: 109,614,614	H33L	unknown	Het
Prl8a6	A	T	13: 27,437,047	Y67N	possibly damaging	Het
Rcor1	A	T	12: 111,108,888	E383V	probably damaging	Het
Slc22a27	A	T	19: 7,926,579	S64R	probably damaging	Het
Snx7	G	A	3: 117,829,636	Q292*	probably null	Het
Tgm3	C	T	2: 130,041,970	T516M	possibly damaging	Het
Trim9	T	C	12: 70,346,639	E177G	probably damaging	Het
Ttc26	G	A	6: 38,401,144	R297H	possibly damaging	Het
Ttc28	C	A	5: 111,277,025	T1541N	possibly damaging	Het
Ttc8	T	A	12: 98,961,476	L202H	probably damaging	Het
Ttll13	T	C	7: 80,250,182	Y90H	probably damaging	Het
Uba1y	T	G	Y: 825,496	I286S	probably benign	Het
Ubxn11	G	A	4: 134,126,264	A125T	probably damaging	Het
Vmn1r48	A	G	6: 90,036,568	Y92H	possibly damaging	Het
Vmn1r74	T	C	7: 11,847,441	F223L	probably benign	Het
Vwa5b1	G	A	4: 138,586,569	T696I	probably benign	Het
Zfp266	G	T	9: 20,499,599	Y427*	probably null	Het
Zfp362	C	T	4: 128,786,015	C273Y	probably damaging	Het
Zfp385c	T	C	11: 100,632,759	N123S	probably benign	Het
Zfp936	T	A	7: 43,190,043	H311Q	probably damaging	Het

Other mutations in Ap3b2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00772:Ap3b2	APN	7	81471949	missense	probably damaging	0.98
IGL01695:Ap3b2	APN	7	81476939	splice site	probably benign
IGL01876:Ap3b2	APN	7	81473854	splice site	probably null
IGL02132:Ap3b2	APN	7	81460998	missense	unknown
IGL02227:Ap3b2	APN	7	81473404	missense	probably damaging	1.00
IGL02660:Ap3b2	APN	7	81465698	missense	probably benign	0.13
R0045:Ap3b2	UTSW	7	81466193	missense	possibly damaging	0.82
R0045:Ap3b2	UTSW	7	81466193	missense	possibly damaging	0.82
R0142:Ap3b2	UTSW	7	81473080	missense	probably damaging	0.96
R0317:Ap3b2	UTSW	7	81463681	splice site	probably null
R0568:Ap3b2	UTSW	7	81464629	critical splice donor site	probably null
R1035:Ap3b2	UTSW	7	81463911	missense	unknown
R1121:Ap3b2	UTSW	7	81464195	missense	unknown
R1160:Ap3b2	UTSW	7	81466169	critical splice donor site	probably null
R1489:Ap3b2	UTSW	7	81463690	nonsense	probably null
R1542:Ap3b2	UTSW	7	81478077	splice site	probably null
R1652:Ap3b2	UTSW	7	81473399	missense	probably damaging	1.00
R1741:Ap3b2	UTSW	7	81467599	missense	possibly damaging	0.95
R1872:Ap3b2	UTSW	7	81464150	missense	unknown
R2065:Ap3b2	UTSW	7	81463774	missense	unknown
R2353:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R2354:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R2398:Ap3b2	UTSW	7	81477195	missense	probably damaging	0.99
R3421:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3710:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3932:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3933:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R4152:Ap3b2	UTSW	7	81478017	missense	probably damaging	1.00
R4209:Ap3b2	UTSW	7	81477136	missense	probably benign	0.02
R4732:Ap3b2	UTSW	7	81471932	missense	probably damaging	1.00
R4733:Ap3b2	UTSW	7	81471932	missense	probably damaging	1.00
R4841:Ap3b2	UTSW	7	81477930	missense	probably damaging	1.00
R5207:Ap3b2	UTSW	7	81476769	missense	possibly damaging	0.48
R5659:Ap3b2	UTSW	7	81476752	missense	probably damaging	0.98
R6109:Ap3b2	UTSW	7	81493592	missense	possibly damaging	0.55
R6223:Ap3b2	UTSW	7	81473462	nonsense	probably null
R6981:Ap3b2	UTSW	7	81477993	missense	probably damaging	1.00
R7061:Ap3b2	UTSW	7	81461009	missense	unknown
R7317:Ap3b2	UTSW	7	81461028	missense	unknown
R7501:Ap3b2	UTSW	7	81473446	missense	probably damaging	0.99
R7543:Ap3b2	UTSW	7	81466146	splice site	probably null
R7643:Ap3b2	UTSW	7	81477072	missense	probably benign	0.24
R7707:Ap3b2	UTSW	7	81476782	missense	possibly damaging	0.60
R8111:Ap3b2	UTSW	7	81463782	missense	unknown
R8273:Ap3b2	UTSW	7	81463242	missense	unknown
R8325:Ap3b2	UTSW	7	81484489	splice site	probably null
R8355:Ap3b2	UTSW	7	81473103	missense	probably damaging	1.00
X0013:Ap3b2	UTSW	7	81463240	critical splice donor site	probably null
X0028:Ap3b2	UTSW	7	81463764	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGTCTTCTAGGTCAGGGACAG -3'
(R):5'- CCAGGCATGATGACCTGAAAG -3'

Sequencing Primer
(F):5'- GACAGTTTGAATAGGTCAAGCCTC -3'
(R):5'- CCTGAAAGAGATGTTGGACACC -3'

Posted On

2018-11-06