Mutagenetix > Incidental Mutations

Incidental Mutation 'R6901:Olfr694'

538533

Institutional Source

Beutler Lab

Gene Symbol

Olfr694

Ensembl Gene

ENSMUSG00000064223

Gene Name

olfactory receptor 694

Synonyms

MOR283-9, GA_x6K02T2PBJ9-9067220-9066273

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.113) question?

Stock #

R6901 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

106684980-106691814 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 106689189 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 181 (I181V)

Ref Sequence

ENSEMBL: ENSMUSP00000151027 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052535] [ENSMUST00000082091] [ENSMUST00000216118] [ENSMUST00000216895]

Predicted Effect

probably benign
Transcript: ENSMUST00000052535
AA Change: I181V

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000057180
Gene: ENSMUSG00000064223
AA Change: I181V

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	307	4.1e-43	PFAM
Pfam:7tm_1	41	290	9.1e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000082091
AA Change: I181V

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000080740
Gene: ENSMUSG00000064223
AA Change: I181V

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	5.6e-47	PFAM
Pfam:7TM_GPCR_Srsx	35	305	7.6e-6	PFAM
Pfam:7tm_1	41	290	7.1e-24	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000216118
AA Change: I181V

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

Predicted Effect

probably benign
Transcript: ENSMUST00000216895
AA Change: I181V

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.9%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd5	T	A	9: 122,368,155	S136T	probably benign	Het
Anxa10	T	C	8: 62,096,782	T10A	probably damaging	Het
Ap3b1	A	G	13: 94,418,142	E262G	probably benign	Het
Ap3b2	T	C	7: 81,484,912		probably null	Het
Arhgef40	A	G	14: 51,997,368	T1043A	probably damaging	Het
Arhgef5	T	A	6: 43,273,298	S328T	probably benign	Het
Arid4a	A	G	12: 71,067,137	K166R	probably damaging	Het
Cdh12	A	G	15: 21,583,786	I571V	probably benign	Het
Cdh4	G	A	2: 179,860,194	V316I	probably benign	Het
Cebpg	A	T	7: 35,050,777	H20Q	probably benign	Het
Ces4a	G	A	8: 105,146,698	V392I	probably benign	Het
CN725425	C	A	15: 91,240,763	P169T	possibly damaging	Het
Cyp2c54	A	G	19: 40,070,259	F243S	probably damaging	Het
Dkk2	T	A	3: 132,175,126		probably null	Het
Dync2h1	A	G	9: 7,131,855	Y1651H	probably damaging	Het
Dyrk1b	T	A	7: 28,185,117	L346Q	probably damaging	Het
Ephx4	T	C	5: 107,413,561	V85A	probably benign	Het
Etv6	A	G	6: 134,266,458	E392G	probably benign	Het
Fli1	T	A	9: 32,429,925	N202I	probably benign	Het
Gm10093	A	G	17: 78,492,660	E360G	probably benign	Het
Gpc6	G	T	14: 117,951,217	R421L	possibly damaging	Het
Gse1	A	G	8: 120,229,822		probably benign	Het
Hnrnpab	T	C	11: 51,601,848		probably benign	Het
Hyal4	A	G	6: 24,756,191	E136G	probably damaging	Het
Kcna3	C	T	3: 107,036,568	A49V	probably benign	Het
Krt42	C	T	11: 100,269,716	M52I	probably benign	Het
Lyrm4	A	T	13: 36,117,124	Y13N	probably damaging	Het
Map2	C	T	1: 66,421,773	S1576L	possibly damaging	Het
Map3k12	G	T	15: 102,500,629	P817Q	possibly damaging	Het
Map3k12	G	T	15: 102,500,630	P817T	possibly damaging	Het
Masp1	T	C	16: 23,513,834	K84E	probably damaging	Het
Mki67	A	T	7: 135,708,760		probably null	Het
Mrap	C	G	16: 90,749,305	S94C	probably damaging	Het
Mybpc2	C	A	7: 44,505,355	C986F	probably damaging	Het
Nbea	A	C	3: 56,019,415	M789R	probably damaging	Het
Olfr1416	G	T	1: 92,480,605	N5K	probably damaging	Het
Pde4a	A	G	9: 21,204,970	N475S	probably benign	Het
Pex7	C	T	10: 19,860,994	V297I	probably benign	Het
Pkd1l3	A	T	8: 109,614,614	H33L	unknown	Het
Prl8a6	A	T	13: 27,437,047	Y67N	possibly damaging	Het
Rcor1	A	T	12: 111,108,888	E383V	probably damaging	Het
Slc22a27	A	T	19: 7,926,579	S64R	probably damaging	Het
Snx7	G	A	3: 117,829,636	Q292*	probably null	Het
Tgm3	C	T	2: 130,041,970	T516M	possibly damaging	Het
Trim9	T	C	12: 70,346,639	E177G	probably damaging	Het
Ttc26	G	A	6: 38,401,144	R297H	possibly damaging	Het
Ttc28	C	A	5: 111,277,025	T1541N	possibly damaging	Het
Ttc8	T	A	12: 98,961,476	L202H	probably damaging	Het
Ttll13	T	C	7: 80,250,182	Y90H	probably damaging	Het
Uba1y	T	G	Y: 825,496	I286S	probably benign	Het
Ubxn11	G	A	4: 134,126,264	A125T	probably damaging	Het
Vmn1r48	A	G	6: 90,036,568	Y92H	possibly damaging	Het
Vmn1r74	T	C	7: 11,847,441	F223L	probably benign	Het
Vwa5b1	G	A	4: 138,586,569	T696I	probably benign	Het
Zfp266	G	T	9: 20,499,599	Y427*	probably null	Het
Zfp362	C	T	4: 128,786,015	C273Y	probably damaging	Het
Zfp385c	T	C	11: 100,632,759	N123S	probably benign	Het
Zfp936	T	A	7: 43,190,043	H311Q	probably damaging	Het

Other mutations in Olfr694

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01546:Olfr694	APN	7	106689531	missense	probably damaging	1.00
IGL01759:Olfr694	APN	7	106689333	missense	probably benign	0.04
IGL02435:Olfr694	APN	7	106689503	missense	probably benign	0.26
IGL02569:Olfr694	APN	7	106689642	missense	probably benign	0.19
IGL02611:Olfr694	APN	7	106688789	missense	probably benign	0.11
IGL02726:Olfr694	APN	7	106689370	nonsense	probably null
IGL02944:Olfr694	APN	7	106689269	missense	probably damaging	1.00
IGL03155:Olfr694	APN	7	106689239	missense	probably damaging	1.00
R0238:Olfr694	UTSW	7	106689255	missense	probably benign	0.00
R0238:Olfr694	UTSW	7	106689255	missense	probably benign	0.00
R0239:Olfr694	UTSW	7	106689255	missense	probably benign	0.00
R0239:Olfr694	UTSW	7	106689255	missense	probably benign	0.00
R0609:Olfr694	UTSW	7	106688998	missense	probably damaging	1.00
R0655:Olfr694	UTSW	7	106689425	missense	probably damaging	1.00
R1562:Olfr694	UTSW	7	106688980	missense	probably benign	0.01
R1641:Olfr694	UTSW	7	106689711	missense	probably benign	0.36
R2144:Olfr694	UTSW	7	106688957	missense	probably damaging	0.99
R4416:Olfr694	UTSW	7	106689011	missense	probably benign	0.07
R4444:Olfr694	UTSW	7	106689146	missense	possibly damaging	0.60
R4445:Olfr694	UTSW	7	106689146	missense	possibly damaging	0.60
R4567:Olfr694	UTSW	7	106689213	nonsense	probably null
R4739:Olfr694	UTSW	7	106689144	nonsense	probably null
R4778:Olfr694	UTSW	7	106689667	missense	probably damaging	0.97
R4908:Olfr694	UTSW	7	106689533	missense	probably damaging	1.00
R5244:Olfr694	UTSW	7	106689189	missense	probably benign	0.12
R5944:Olfr694	UTSW	7	106689646	nonsense	probably null
R6260:Olfr694	UTSW	7	106688872	missense	probably damaging	1.00
R6573:Olfr694	UTSW	7	106689463	missense	probably benign	0.00
R7230:Olfr694	UTSW	7	106689524	missense	possibly damaging	0.94
R7420:Olfr694	UTSW	7	106689020	missense	possibly damaging	0.74
R7426:Olfr694	UTSW	7	106689210	missense	possibly damaging	0.88
U24488:Olfr694	UTSW	7	106689089	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAACCACAGTCAGATGGGAAG -3'
(R):5'- TTGGTAGTGCAGAGGACCTC -3'

Sequencing Primer
(F):5'- CCACAGTCAGATGGGAAGAGCAG -3'
(R):5'- CCTTCATGGCCTATGACAGG -3'

Posted On

2018-11-06