Incidental Mutation 'R6901:Prl8a6'
ID538552
Institutional Source Beutler Lab
Gene Symbol Prl8a6
Ensembl Gene ENSMUSG00000021345
Gene Nameprolactin family 8, subfamily a, member 6
SynonymsPrlpc1, PLP-Ca, PLP-calpha, Prlpc
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R6901 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location27432681-27438688 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 27437047 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 67 (Y67N)
Ref Sequence ENSEMBL: ENSMUSP00000105984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018392] [ENSMUST00000080762] [ENSMUST00000110355]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018392
AA Change: Y66N

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000018392
Gene: ENSMUSG00000021345
AA Change: Y66N

DomainStartEndE-ValueType
Pfam:Hormone_1 16 239 2.8e-56 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000080762
AA Change: Y67N

PolyPhen 2 Score 0.844 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000079584
Gene: ENSMUSG00000021345
AA Change: Y67N

DomainStartEndE-ValueType
Pfam:Hormone_1 17 86 1.9e-13 PFAM
Pfam:Hormone_1 83 205 2.4e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110355
AA Change: Y67N

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105984
Gene: ENSMUSG00000021345
AA Change: Y67N

DomainStartEndE-ValueType
Pfam:Hormone_1 17 240 1e-58 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd5 T A 9: 122,368,155 S136T probably benign Het
Anxa10 T C 8: 62,096,782 T10A probably damaging Het
Ap3b1 A G 13: 94,418,142 E262G probably benign Het
Ap3b2 T C 7: 81,484,912 probably null Het
Arhgef40 A G 14: 51,997,368 T1043A probably damaging Het
Arhgef5 T A 6: 43,273,298 S328T probably benign Het
Arid4a A G 12: 71,067,137 K166R probably damaging Het
Cdh12 A G 15: 21,583,786 I571V probably benign Het
Cdh4 G A 2: 179,860,194 V316I probably benign Het
Cebpg A T 7: 35,050,777 H20Q probably benign Het
Ces4a G A 8: 105,146,698 V392I probably benign Het
CN725425 C A 15: 91,240,763 P169T possibly damaging Het
Cyp2c54 A G 19: 40,070,259 F243S probably damaging Het
Dkk2 T A 3: 132,175,126 probably null Het
Dync2h1 A G 9: 7,131,855 Y1651H probably damaging Het
Dyrk1b T A 7: 28,185,117 L346Q probably damaging Het
Ephx4 T C 5: 107,413,561 V85A probably benign Het
Etv6 A G 6: 134,266,458 E392G probably benign Het
Fli1 T A 9: 32,429,925 N202I probably benign Het
Gm10093 A G 17: 78,492,660 E360G probably benign Het
Gpc6 G T 14: 117,951,217 R421L possibly damaging Het
Gse1 A G 8: 120,229,822 probably benign Het
Hnrnpab T C 11: 51,601,848 probably benign Het
Hyal4 A G 6: 24,756,191 E136G probably damaging Het
Kcna3 C T 3: 107,036,568 A49V probably benign Het
Krt42 C T 11: 100,269,716 M52I probably benign Het
Lyrm4 A T 13: 36,117,124 Y13N probably damaging Het
Map2 C T 1: 66,421,773 S1576L possibly damaging Het
Map3k12 G T 15: 102,500,629 P817Q possibly damaging Het
Map3k12 G T 15: 102,500,630 P817T possibly damaging Het
Masp1 T C 16: 23,513,834 K84E probably damaging Het
Mki67 A T 7: 135,708,760 probably null Het
Mrap C G 16: 90,749,305 S94C probably damaging Het
Mybpc2 C A 7: 44,505,355 C986F probably damaging Het
Nbea A C 3: 56,019,415 M789R probably damaging Het
Olfr1416 G T 1: 92,480,605 N5K probably damaging Het
Olfr694 T C 7: 106,689,189 I181V probably benign Het
Pde4a A G 9: 21,204,970 N475S probably benign Het
Pex7 C T 10: 19,860,994 V297I probably benign Het
Pkd1l3 A T 8: 109,614,614 H33L unknown Het
Rcor1 A T 12: 111,108,888 E383V probably damaging Het
Slc22a27 A T 19: 7,926,579 S64R probably damaging Het
Snx7 G A 3: 117,829,636 Q292* probably null Het
Tgm3 C T 2: 130,041,970 T516M possibly damaging Het
Trim9 T C 12: 70,346,639 E177G probably damaging Het
Ttc26 G A 6: 38,401,144 R297H possibly damaging Het
Ttc28 C A 5: 111,277,025 T1541N possibly damaging Het
Ttc8 T A 12: 98,961,476 L202H probably damaging Het
Ttll13 T C 7: 80,250,182 Y90H probably damaging Het
Uba1y T G Y: 825,496 I286S probably benign Het
Ubxn11 G A 4: 134,126,264 A125T probably damaging Het
Vmn1r48 A G 6: 90,036,568 Y92H possibly damaging Het
Vmn1r74 T C 7: 11,847,441 F223L probably benign Het
Vwa5b1 G A 4: 138,586,569 T696I probably benign Het
Zfp266 G T 9: 20,499,599 Y427* probably null Het
Zfp362 C T 4: 128,786,015 C273Y probably damaging Het
Zfp385c T C 11: 100,632,759 N123S probably benign Het
Zfp936 T A 7: 43,190,043 H311Q probably damaging Het
Other mutations in Prl8a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
P0157:Prl8a6 UTSW 13 27436179 splice site probably benign
R0115:Prl8a6 UTSW 13 27433101 missense probably benign 0.07
R0481:Prl8a6 UTSW 13 27433101 missense probably benign 0.07
R0514:Prl8a6 UTSW 13 27433007 nonsense probably null
R2209:Prl8a6 UTSW 13 27435386 missense probably benign 0.03
R2329:Prl8a6 UTSW 13 27437067 missense probably benign
R3876:Prl8a6 UTSW 13 27433032 nonsense probably null
R5259:Prl8a6 UTSW 13 27436196 nonsense probably null
R5800:Prl8a6 UTSW 13 27435470 missense probably benign
R5921:Prl8a6 UTSW 13 27437188 missense probably damaging 1.00
R7182:Prl8a6 UTSW 13 27437170 missense probably damaging 1.00
R7230:Prl8a6 UTSW 13 27433038 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCGCTGTACTAAAAGAACATGG -3'
(R):5'- TCTATGTAGCAGGTCCACTCC -3'

Sequencing Primer
(F):5'- GGCCAATAGAATTTCATGTTCCC -3'
(R):5'- AGGTCCACTCCTGCTGCTG -3'
Posted On2018-11-06