Incidental Mutation 'R6902:Prdm14'
ID538567
Institutional Source Beutler Lab
Gene Symbol Prdm14
Ensembl Gene ENSMUSG00000042414
Gene NamePR domain containing 14
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6902 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location13113457-13127163 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 13122421 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 365 (V365I)
Ref Sequence ENSEMBL: ENSMUSP00000044245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047577]
Predicted Effect probably benign
Transcript: ENSMUST00000047577
AA Change: V365I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044245
Gene: ENSMUSG00000042414
AA Change: V365I

DomainStartEndE-ValueType
low complexity region 120 139 N/A INTRINSIC
SET 244 362 2.8e-11 SMART
low complexity region 373 389 N/A INTRINSIC
ZnF_C2H2 390 410 1.4e-1 SMART
ZnF_C2H2 422 445 5.3e-5 SMART
ZnF_C2H2 451 473 3.2e-7 SMART
ZnF_C2H2 479 501 1.4e-4 SMART
ZnF_C2H2 507 530 8.1e-5 SMART
ZnF_C2H2 536 558 4.6e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.6%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PRDI-BF1 and RIZ homology domain containing (PRDM) family of transcriptional regulators. The encoded protein may possess histone methyltransferase activity and plays a critical role in cell pluripotency by suppressing the expression of differentiation marker genes. Expression of this gene may play a role in breast cancer. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knockout allele exhibit decreased primordial germ cell numbers, absent germ cells, and sterility in both males and females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik C G 13: 119,488,144 probably benign Het
9530053A07Rik C T 7: 28,137,213 R186C probably damaging Het
Abcc9 T A 6: 142,679,227 S481C probably damaging Het
Adgrl3 C A 5: 81,689,587 S773R probably damaging Het
Alkbh5 G A 11: 60,538,555 A45T probably benign Het
Ankrd6 C A 4: 32,806,419 Q576H probably damaging Het
Ankrd6 T A 4: 32,806,420 Q576L probably damaging Het
Carmil1 T C 13: 24,115,545 N332S possibly damaging Het
Cc2d2b A G 19: 40,816,289 Q1250R possibly damaging Het
Chd9 A C 8: 91,042,951 N2539T probably damaging Het
Clec4b2 C T 6: 123,201,028 Q101* probably null Het
Clstn2 A T 9: 97,469,822 F517I probably damaging Het
Cog2 A G 8: 124,546,691 K590E probably damaging Het
Coq9 G A 8: 94,850,552 E182K probably benign Het
Focad C T 4: 88,230,476 R477C unknown Het
Gja10 G T 4: 32,601,905 H160N probably damaging Het
Gm1673 G A 5: 33,983,579 probably benign Het
Gpr132 T A 12: 112,852,210 Y332F probably benign Het
Herc2 A G 7: 56,135,486 T1495A probably benign Het
Hivep3 T A 4: 120,095,995 S503T possibly damaging Het
Ifi44 A T 3: 151,745,899 I190N possibly damaging Het
Igf1r T A 7: 68,004,163 C150S probably damaging Het
Ighv1-42 T A 12: 114,937,535 N4Y possibly damaging Het
Klra9 T A 6: 130,179,040 I251F probably benign Het
Krt79 T C 15: 101,931,879 N294S probably benign Het
Lama2 T G 10: 26,981,629 T3075P probably damaging Het
Lrfn1 T G 7: 28,459,813 C386G probably benign Het
Lrp2 T C 2: 69,459,503 D3664G probably damaging Het
Mfsd3 T A 15: 76,703,149 M344K probably damaging Het
Mier2 C A 10: 79,540,839 probably benign Het
Mmp2 G A 8: 92,836,917 V340M probably damaging Het
Mrgprb3 T A 7: 48,643,699 I35F probably benign Het
Myo5b A T 18: 74,676,685 I613F possibly damaging Het
Olfr299 T A 7: 86,465,787 C125* probably null Het
Olfr585 A T 7: 103,098,355 I205F probably benign Het
Olfr867 A T 9: 20,055,374 L30M possibly damaging Het
Olfr948 C A 9: 39,319,019 L198F probably damaging Het
Pan2 A G 10: 128,315,637 T867A probably benign Het
Papolb T A 5: 142,528,151 H579L probably benign Het
Pcf11 C A 7: 92,658,299 G887V probably damaging Het
Pdzd8 A G 19: 59,301,397 S524P possibly damaging Het
Pole3 T C 4: 62,524,063 probably benign Het
Shank1 T A 7: 44,356,815 F1985L probably benign Het
Slc13a1 T C 6: 24,097,666 I421V possibly damaging Het
Slc2a6 C T 2: 27,023,160 V374M probably benign Het
Spata1 A T 3: 146,475,323 N293K possibly damaging Het
Stk40 T A 4: 126,137,812 D366E probably benign Het
Tas2r117 T C 6: 132,803,325 L142S probably damaging Het
Tcrg-V1 T C 13: 19,340,020 L2P probably benign Het
Tomm70a T C 16: 57,138,081 S266P probably damaging Het
Vipr2 A T 12: 116,139,199 T310S possibly damaging Het
Vti1a A T 19: 55,499,241 probably null Het
Zfp961 A G 8: 71,968,678 K345R probably damaging Het
Other mutations in Prdm14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02149:Prdm14 APN 1 13125439 missense probably benign 0.07
R0099:Prdm14 UTSW 1 13118945 missense probably damaging 0.96
R0243:Prdm14 UTSW 1 13122448 missense probably damaging 1.00
R0312:Prdm14 UTSW 1 13118807 missense probably damaging 1.00
R0576:Prdm14 UTSW 1 13125725 missense possibly damaging 0.87
R0781:Prdm14 UTSW 1 13114361 missense probably damaging 0.99
R0791:Prdm14 UTSW 1 13125744 missense probably benign 0.30
R0792:Prdm14 UTSW 1 13125744 missense probably benign 0.30
R0855:Prdm14 UTSW 1 13125537 missense probably benign 0.00
R0905:Prdm14 UTSW 1 13125438 missense probably benign 0.00
R1467:Prdm14 UTSW 1 13124532 splice site probably benign
R1747:Prdm14 UTSW 1 13122403 missense possibly damaging 0.83
R1771:Prdm14 UTSW 1 13118858 missense probably damaging 1.00
R2073:Prdm14 UTSW 1 13125730 missense possibly damaging 0.95
R2170:Prdm14 UTSW 1 13122460 missense probably damaging 1.00
R2432:Prdm14 UTSW 1 13125633 missense probably benign
R4948:Prdm14 UTSW 1 13122631 missense probably damaging 1.00
R6267:Prdm14 UTSW 1 13118936 missense probably damaging 1.00
R7452:Prdm14 UTSW 1 13125559 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCCACAATATGCTGGCATGC -3'
(R):5'- AAGGTTCTGGGAACTGGATG -3'

Sequencing Primer
(F):5'- CAATATGCTGGCATGCGTTCTTTG -3'
(R):5'- GGAACTGGATGTCCTATGTCAAC -3'
Posted On2018-11-06