Incidental Mutation 'R6902:Ankrd6'
ID538574
Institutional Source Beutler Lab
Gene Symbol Ankrd6
Ensembl Gene ENSMUSG00000040183
Gene Nameankyrin repeat domain 6
Synonymsdiversin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6902 (G1)
Quality Score208.009
Status Validated
Chromosome4
Chromosomal Location32804035-32950841 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32806420 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 576 (Q576L)
Ref Sequence ENSEMBL: ENSMUSP00000081800 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035719] [ENSMUST00000084748] [ENSMUST00000084749] [ENSMUST00000084750] [ENSMUST00000108166]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035719
AA Change: Q611L

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000041300
Gene: ENSMUSG00000040183
AA Change: Q611L

DomainStartEndE-ValueType
ANK 9 38 2.55e2 SMART
ANK 41 70 2.08e-7 SMART
ANK 74 103 3.49e0 SMART
ANK 107 136 5.24e-4 SMART
ANK 140 169 3.74e0 SMART
ANK 173 202 6.12e-5 SMART
ANK 206 235 5.32e-5 SMART
ANK 239 268 6.24e2 SMART
low complexity region 365 377 N/A INTRINSIC
coiled coil region 417 445 N/A INTRINSIC
low complexity region 536 556 N/A INTRINSIC
low complexity region 625 643 N/A INTRINSIC
coiled coil region 672 712 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000084748
AA Change: Q576L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000081800
Gene: ENSMUSG00000040183
AA Change: Q576L

DomainStartEndE-ValueType
ANK 9 38 2.55e2 SMART
ANK 41 70 2.08e-7 SMART
ANK 74 103 3.49e0 SMART
ANK 107 136 5.24e-4 SMART
ANK 140 169 3.74e0 SMART
ANK 173 202 6.12e-5 SMART
ANK 206 235 5.32e-5 SMART
ANK 239 269 2.11e2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 382 410 N/A INTRINSIC
low complexity region 501 521 N/A INTRINSIC
low complexity region 590 608 N/A INTRINSIC
coiled coil region 637 677 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000084749
AA Change: Q611L

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000081801
Gene: ENSMUSG00000040183
AA Change: Q611L

DomainStartEndE-ValueType
ANK 9 38 2.55e2 SMART
ANK 41 70 2.08e-7 SMART
ANK 74 103 3.49e0 SMART
ANK 107 136 5.24e-4 SMART
ANK 140 169 3.74e0 SMART
ANK 173 202 6.12e-5 SMART
ANK 206 235 5.32e-5 SMART
ANK 239 268 6.24e2 SMART
low complexity region 365 377 N/A INTRINSIC
coiled coil region 417 445 N/A INTRINSIC
low complexity region 536 556 N/A INTRINSIC
low complexity region 625 643 N/A INTRINSIC
coiled coil region 672 712 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000084750
AA Change: Q611L

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000081802
Gene: ENSMUSG00000040183
AA Change: Q611L

DomainStartEndE-ValueType
ANK 9 38 2.55e2 SMART
ANK 41 70 2.08e-7 SMART
ANK 74 103 3.49e0 SMART
ANK 107 136 5.24e-4 SMART
ANK 140 169 3.74e0 SMART
ANK 173 202 6.12e-5 SMART
ANK 206 235 5.32e-5 SMART
ANK 239 268 6.24e2 SMART
low complexity region 365 377 N/A INTRINSIC
coiled coil region 417 445 N/A INTRINSIC
low complexity region 536 556 N/A INTRINSIC
low complexity region 625 643 N/A INTRINSIC
coiled coil region 672 712 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108166
AA Change: Q547L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103801
Gene: ENSMUSG00000040183
AA Change: Q547L

DomainStartEndE-ValueType
ANK 9 38 2.55e2 SMART
ANK 41 70 2.08e-7 SMART
ANK 74 103 3.49e0 SMART
ANK 107 136 3.74e0 SMART
ANK 140 169 6.12e-5 SMART
ANK 173 202 5.32e-5 SMART
low complexity region 207 227 N/A INTRINSIC
low complexity region 306 318 N/A INTRINSIC
coiled coil region 358 386 N/A INTRINSIC
low complexity region 468 491 N/A INTRINSIC
low complexity region 561 579 N/A INTRINSIC
coiled coil region 608 648 N/A INTRINSIC
Meta Mutation Damage Score 0.1329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.6%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: This gene encodes a protein which is thought to be involved in the Wnt signaling pathway and embryonic axis formation. Similar genes have been found in human, rhesus macaque, and zebrafish. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display sporadic disruption of utricle hair cell polarity but normal cochlear and vestibular hair cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik C G 13: 119,488,144 probably benign Het
9530053A07Rik C T 7: 28,137,213 R186C probably damaging Het
Abcc9 T A 6: 142,679,227 S481C probably damaging Het
Adgrl3 C A 5: 81,689,587 S773R probably damaging Het
Alkbh5 G A 11: 60,538,555 A45T probably benign Het
Carmil1 T C 13: 24,115,545 N332S possibly damaging Het
Cc2d2b A G 19: 40,816,289 Q1250R possibly damaging Het
Chd9 A C 8: 91,042,951 N2539T probably damaging Het
Clec4b2 C T 6: 123,201,028 Q101* probably null Het
Clstn2 A T 9: 97,469,822 F517I probably damaging Het
Cog2 A G 8: 124,546,691 K590E probably damaging Het
Coq9 G A 8: 94,850,552 E182K probably benign Het
Focad C T 4: 88,230,476 R477C unknown Het
Gja10 G T 4: 32,601,905 H160N probably damaging Het
Gm1673 G A 5: 33,983,579 probably benign Het
Gpr132 T A 12: 112,852,210 Y332F probably benign Het
Herc2 A G 7: 56,135,486 T1495A probably benign Het
Hivep3 T A 4: 120,095,995 S503T possibly damaging Het
Ifi44 A T 3: 151,745,899 I190N possibly damaging Het
Igf1r T A 7: 68,004,163 C150S probably damaging Het
Ighv1-42 T A 12: 114,937,535 N4Y possibly damaging Het
Klra9 T A 6: 130,179,040 I251F probably benign Het
Krt79 T C 15: 101,931,879 N294S probably benign Het
Lama2 T G 10: 26,981,629 T3075P probably damaging Het
Lrfn1 T G 7: 28,459,813 C386G probably benign Het
Lrp2 T C 2: 69,459,503 D3664G probably damaging Het
Mfsd3 T A 15: 76,703,149 M344K probably damaging Het
Mier2 C A 10: 79,540,839 probably benign Het
Mmp2 G A 8: 92,836,917 V340M probably damaging Het
Mrgprb3 T A 7: 48,643,699 I35F probably benign Het
Myo5b A T 18: 74,676,685 I613F possibly damaging Het
Olfr299 T A 7: 86,465,787 C125* probably null Het
Olfr585 A T 7: 103,098,355 I205F probably benign Het
Olfr867 A T 9: 20,055,374 L30M possibly damaging Het
Olfr948 C A 9: 39,319,019 L198F probably damaging Het
Pan2 A G 10: 128,315,637 T867A probably benign Het
Papolb T A 5: 142,528,151 H579L probably benign Het
Pcf11 C A 7: 92,658,299 G887V probably damaging Het
Pdzd8 A G 19: 59,301,397 S524P possibly damaging Het
Pole3 T C 4: 62,524,063 probably benign Het
Prdm14 C T 1: 13,122,421 V365I probably benign Het
Shank1 T A 7: 44,356,815 F1985L probably benign Het
Slc13a1 T C 6: 24,097,666 I421V possibly damaging Het
Slc2a6 C T 2: 27,023,160 V374M probably benign Het
Spata1 A T 3: 146,475,323 N293K possibly damaging Het
Stk40 T A 4: 126,137,812 D366E probably benign Het
Tas2r117 T C 6: 132,803,325 L142S probably damaging Het
Tcrg-V1 T C 13: 19,340,020 L2P probably benign Het
Tomm70a T C 16: 57,138,081 S266P probably damaging Het
Vipr2 A T 12: 116,139,199 T310S possibly damaging Het
Vti1a A T 19: 55,499,241 probably null Het
Zfp961 A G 8: 71,968,678 K345R probably damaging Het
Other mutations in Ankrd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02489:Ankrd6 APN 4 32810298 missense probably damaging 1.00
IGL03247:Ankrd6 APN 4 32860441 start codon destroyed possibly damaging 0.76
IGL03382:Ankrd6 APN 4 32808771 missense probably damaging 1.00
R0360:Ankrd6 UTSW 4 32836424 missense probably damaging 1.00
R0711:Ankrd6 UTSW 4 32815326 missense probably damaging 1.00
R1074:Ankrd6 UTSW 4 32822232 missense probably damaging 1.00
R1075:Ankrd6 UTSW 4 32822232 missense probably damaging 1.00
R1498:Ankrd6 UTSW 4 32810289 missense probably benign 0.17
R1719:Ankrd6 UTSW 4 32828774 missense probably damaging 1.00
R1823:Ankrd6 UTSW 4 32824427 missense probably damaging 1.00
R2889:Ankrd6 UTSW 4 32818704 missense probably damaging 0.99
R2897:Ankrd6 UTSW 4 32860438 missense probably damaging 0.98
R3815:Ankrd6 UTSW 4 32806206 missense probably benign 0.39
R3836:Ankrd6 UTSW 4 32817531 missense probably damaging 1.00
R4127:Ankrd6 UTSW 4 32822241 missense probably damaging 1.00
R4994:Ankrd6 UTSW 4 32860387 missense probably damaging 0.99
R5250:Ankrd6 UTSW 4 32860335 missense probably damaging 1.00
R5291:Ankrd6 UTSW 4 32823446 missense probably damaging 1.00
R5335:Ankrd6 UTSW 4 32818651 missense probably damaging 1.00
R5948:Ankrd6 UTSW 4 32817075 missense possibly damaging 0.91
R6336:Ankrd6 UTSW 4 32860411 missense probably damaging 1.00
R6345:Ankrd6 UTSW 4 32810266 missense probably damaging 1.00
R6349:Ankrd6 UTSW 4 32822231 missense probably damaging 1.00
R6516:Ankrd6 UTSW 4 32836427 missense probably damaging 1.00
R6902:Ankrd6 UTSW 4 32806419 missense probably damaging 1.00
R6999:Ankrd6 UTSW 4 32823459 missense probably benign
R7044:Ankrd6 UTSW 4 32815260 missense possibly damaging 0.93
R7307:Ankrd6 UTSW 4 32816949 missense possibly damaging 0.92
R7394:Ankrd6 UTSW 4 32821298 missense probably damaging 0.99
R7496:Ankrd6 UTSW 4 32810299 missense probably damaging 0.99
R7662:Ankrd6 UTSW 4 32818694 missense probably damaging 1.00
R7873:Ankrd6 UTSW 4 32806499 missense possibly damaging 0.91
R7956:Ankrd6 UTSW 4 32806499 missense possibly damaging 0.91
X0064:Ankrd6 UTSW 4 32806435 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CTTTTCCATCTGTGCAGAAACG -3'
(R):5'- AACAGCTGTAGACCAACCAGTG -3'

Sequencing Primer
(F):5'- ATCTGTGCAGAAACGGCCTC -3'
(R):5'- CAACCAGTGGTAGCTGCAG -3'
Posted On2018-11-06