Incidental Mutation 'R6902:Adgrl3'
ID538580
Institutional Source Beutler Lab
Gene Symbol Adgrl3
Ensembl Gene ENSMUSG00000037605
Gene Nameadhesion G protein-coupled receptor L3
SynonymsLEC3, 5430402I23Rik, lectomedin 3, Lphn3, D130075K09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6902 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location81020138-81825133 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 81689587 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 773 (S773R)
Ref Sequence ENSEMBL: ENSMUSP00000112823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036068] [ENSMUST00000072521] [ENSMUST00000117253] [ENSMUST00000117407] [ENSMUST00000117985] [ENSMUST00000118034] [ENSMUST00000118078] [ENSMUST00000118442] [ENSMUST00000119385] [ENSMUST00000119788] [ENSMUST00000120128] [ENSMUST00000120144] [ENSMUST00000120292] [ENSMUST00000120445] [ENSMUST00000120673] [ENSMUST00000121641] [ENSMUST00000121707] [ENSMUST00000122037] [ENSMUST00000122356] [ENSMUST00000132375]
Predicted Effect probably damaging
Transcript: ENSMUST00000036068
AA Change: S773R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045342
Gene: ENSMUSG00000037605
AA Change: S773R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 6.6e-27 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 1.1e-7 PFAM
Pfam:DUF3497 627 857 2.2e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1187 4.4e-72 PFAM
Pfam:Latrophilin 1206 1276 2.4e-30 PFAM
Pfam:Latrophilin 1272 1543 3.2e-113 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000072521
AA Change: S773R

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000072336
Gene: ENSMUSG00000037605
AA Change: S773R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 5.9e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 4.3e-8 PFAM
Pfam:GAIN 630 856 1.2e-58 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1187 2.5e-73 PFAM
Pfam:Latrophilin 1207 1274 4e-34 PFAM
Pfam:Latrophilin 1272 1543 5e-89 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117253
AA Change: S705R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112470
Gene: ENSMUSG00000037605
AA Change: S705R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 1e-26 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 4.5e-8 PFAM
Pfam:DUF3497 559 789 1.2e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1110 5e-73 PFAM
Pfam:Latrophilin 1129 1265 7.5e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117407
AA Change: S773R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112388
Gene: ENSMUSG00000037605
AA Change: S773R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 2.4e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 6e-8 PFAM
Pfam:DUF3497 627 857 2.6e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1178 7.7e-73 PFAM
Pfam:Latrophilin 1197 1321 1.8e-61 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117985
AA Change: S705R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113950
Gene: ENSMUSG00000037605
AA Change: S705R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 1.3e-26 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 5.5e-8 PFAM
Pfam:DUF3497 559 789 1.6e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1119 1.7e-72 PFAM
Pfam:Latrophilin 1138 1512 6.8e-178 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118034
AA Change: S705R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113534
Gene: ENSMUSG00000037605
AA Change: S705R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 1.2e-26 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 5.5e-8 PFAM
Pfam:DUF3497 559 789 1.6e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1110 6.6e-73 PFAM
Pfam:Latrophilin 1129 1503 6.7e-178 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118078
AA Change: S705R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112731
Gene: ENSMUSG00000037605
AA Change: S705R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 9.7e-27 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 4.3e-8 PFAM
Pfam:DUF3497 559 789 1.2e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1110 4.8e-73 PFAM
Pfam:Latrophilin 1129 1201 2.6e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118442
AA Change: S773R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113836
Gene: ENSMUSG00000037605
AA Change: S773R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 1e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 4.7e-8 PFAM
Pfam:DUF3497 627 857 1.3e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1187 1.4e-72 PFAM
Pfam:Latrophilin 1206 1278 2.8e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119385
AA Change: S773R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113243
Gene: ENSMUSG00000037605
AA Change: S773R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 1e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 4.6e-8 PFAM
Pfam:DUF3497 627 857 1.3e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1178 5.2e-73 PFAM
Pfam:Latrophilin 1197 1269 2.7e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119788
AA Change: S773R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114067
Gene: ENSMUSG00000037605
AA Change: S773R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 1.3e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 5.7e-8 PFAM
Pfam:DUF3497 627 857 1.7e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1187 1.8e-72 PFAM
Pfam:Latrophilin 1206 1279 3.6e-31 PFAM
Pfam:Latrophilin 1273 1550 4.5e-113 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120128
AA Change: S705R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113208
Gene: ENSMUSG00000037605
AA Change: S705R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 9.8e-27 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 4.4e-8 PFAM
Pfam:DUF3497 559 789 1.2e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1119 1.3e-72 PFAM
Pfam:Latrophilin 1138 1210 2.6e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120144
AA Change: S705R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113619
Gene: ENSMUSG00000037605
AA Change: S705R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 1e-26 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 4.5e-8 PFAM
Pfam:DUF3497 559 789 1.3e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1110 5.1e-73 PFAM
Pfam:Latrophilin 1129 1253 8.4e-62 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120292
AA Change: S705R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112548
Gene: ENSMUSG00000037605
AA Change: S705R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 1e-26 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 4.5e-8 PFAM
Pfam:DUF3497 559 789 1.3e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1119 1.3e-72 PFAM
Pfam:Latrophilin 1138 1262 8.5e-62 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120445
AA Change: S773R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113249
Gene: ENSMUSG00000037605
AA Change: S773R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 2.2e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 2.8e-8 PFAM
Pfam:GAIN 630 856 5.1e-59 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1187 1.4e-73 PFAM
Pfam:Latrophilin 1207 1328 8e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120673
AA Change: S773R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113482
Gene: ENSMUSG00000037605
AA Change: S773R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 2.7e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 3.3e-8 PFAM
Pfam:GAIN 630 856 6.4e-59 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1187 1.8e-73 PFAM
Pfam:Latrophilin 1207 1580 1.4e-158 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121641
AA Change: S773R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113694
Gene: ENSMUSG00000037605
AA Change: S773R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 1.3e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 5.8e-8 PFAM
Pfam:DUF3497 627 857 1.7e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1178 7e-73 PFAM
Pfam:Latrophilin 1197 1571 7.3e-178 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121707
AA Change: S773R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112823
Gene: ENSMUSG00000037605
AA Change: S773R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 1.3e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 5.6e-8 PFAM
Pfam:DUF3497 627 857 1.7e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1178 6.8e-73 PFAM
Pfam:Latrophilin 1197 1267 6.4e-30 PFAM
Pfam:Latrophilin 1263 1534 8.7e-113 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122037
AA Change: S705R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113374
Gene: ENSMUSG00000037605
AA Change: S705R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 1.2e-26 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 5.3e-8 PFAM
Pfam:DUF3497 559 789 1.5e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1110 6.3e-73 PFAM
Pfam:Latrophilin 1129 1199 4.4e-30 PFAM
Pfam:Latrophilin 1194 1460 1.3e-112 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122356
AA Change: S773R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113600
Gene: ENSMUSG00000037605
AA Change: S773R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 2.8e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 7e-8 PFAM
Pfam:DUF3497 627 857 3.1e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1178 9.3e-73 PFAM
Pfam:Latrophilin 1197 1267 9e-30 PFAM
Pfam:Latrophilin 1262 1528 2.8e-112 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000118882
Gene: ENSMUSG00000037605
AA Change: S117R

DomainStartEndE-ValueType
Pfam:GAIN 2 201 1.8e-51 PFAM
GPS 227 279 3.72e-25 SMART
Pfam:7tm_2 287 523 9.1e-75 PFAM
Pfam:Latrophilin 543 610 7.2e-35 PFAM
Pfam:Latrophilin 607 873 1.8e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132375
SMART Domains Protein: ENSMUSP00000117211
Gene: ENSMUSG00000037605

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Meta Mutation Damage Score 0.2720 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.6%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the latrophilin subfamily of G-protein coupled receptors (GPCR). Latrophilins may function in both cell adhesion and signal transduction. In experiments with non-human species, endogenous proteolytic cleavage within a cysteine-rich GPS (G-protein-coupled-receptor proteolysis site) domain resulted in two subunits (a large extracellular N-terminal cell adhesion subunit and a subunit with substantial similarity to the secretin/calcitonin family of GPCRs) being non-covalently bound at the cell membrane. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased dopamine and serotonine levels in the dorsal striatum, hyperactivity, increased stereotypic behavior and enhanced hyperactivity in response to cocaine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik C G 13: 119,488,144 probably benign Het
9530053A07Rik C T 7: 28,137,213 R186C probably damaging Het
Abcc9 T A 6: 142,679,227 S481C probably damaging Het
Alkbh5 G A 11: 60,538,555 A45T probably benign Het
Ankrd6 C A 4: 32,806,419 Q576H probably damaging Het
Ankrd6 T A 4: 32,806,420 Q576L probably damaging Het
Carmil1 T C 13: 24,115,545 N332S possibly damaging Het
Cc2d2b A G 19: 40,816,289 Q1250R possibly damaging Het
Chd9 A C 8: 91,042,951 N2539T probably damaging Het
Clec4b2 C T 6: 123,201,028 Q101* probably null Het
Clstn2 A T 9: 97,469,822 F517I probably damaging Het
Cog2 A G 8: 124,546,691 K590E probably damaging Het
Coq9 G A 8: 94,850,552 E182K probably benign Het
Focad C T 4: 88,230,476 R477C unknown Het
Gja10 G T 4: 32,601,905 H160N probably damaging Het
Gm1673 G A 5: 33,983,579 probably benign Het
Gpr132 T A 12: 112,852,210 Y332F probably benign Het
Herc2 A G 7: 56,135,486 T1495A probably benign Het
Hivep3 T A 4: 120,095,995 S503T possibly damaging Het
Ifi44 A T 3: 151,745,899 I190N possibly damaging Het
Igf1r T A 7: 68,004,163 C150S probably damaging Het
Ighv1-42 T A 12: 114,937,535 N4Y possibly damaging Het
Klra9 T A 6: 130,179,040 I251F probably benign Het
Krt79 T C 15: 101,931,879 N294S probably benign Het
Lama2 T G 10: 26,981,629 T3075P probably damaging Het
Lrfn1 T G 7: 28,459,813 C386G probably benign Het
Lrp2 T C 2: 69,459,503 D3664G probably damaging Het
Mfsd3 T A 15: 76,703,149 M344K probably damaging Het
Mier2 C A 10: 79,540,839 probably benign Het
Mmp2 G A 8: 92,836,917 V340M probably damaging Het
Mrgprb3 T A 7: 48,643,699 I35F probably benign Het
Myo5b A T 18: 74,676,685 I613F possibly damaging Het
Olfr299 T A 7: 86,465,787 C125* probably null Het
Olfr585 A T 7: 103,098,355 I205F probably benign Het
Olfr867 A T 9: 20,055,374 L30M possibly damaging Het
Olfr948 C A 9: 39,319,019 L198F probably damaging Het
Pan2 A G 10: 128,315,637 T867A probably benign Het
Papolb T A 5: 142,528,151 H579L probably benign Het
Pcf11 C A 7: 92,658,299 G887V probably damaging Het
Pdzd8 A G 19: 59,301,397 S524P possibly damaging Het
Pole3 T C 4: 62,524,063 probably benign Het
Prdm14 C T 1: 13,122,421 V365I probably benign Het
Shank1 T A 7: 44,356,815 F1985L probably benign Het
Slc13a1 T C 6: 24,097,666 I421V possibly damaging Het
Slc2a6 C T 2: 27,023,160 V374M probably benign Het
Spata1 A T 3: 146,475,323 N293K possibly damaging Het
Stk40 T A 4: 126,137,812 D366E probably benign Het
Tas2r117 T C 6: 132,803,325 L142S probably damaging Het
Tcrg-V1 T C 13: 19,340,020 L2P probably benign Het
Tomm70a T C 16: 57,138,081 S266P probably damaging Het
Vipr2 A T 12: 116,139,199 T310S possibly damaging Het
Vti1a A T 19: 55,499,241 probably null Het
Zfp961 A G 8: 71,968,678 K345R probably damaging Het
Other mutations in Adgrl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Adgrl3 APN 5 81724224 missense probably damaging 0.99
IGL00596:Adgrl3 APN 5 81646467 missense probably benign 0.01
IGL00766:Adgrl3 APN 5 81794568 missense probably damaging 1.00
IGL00787:Adgrl3 APN 5 81693554 missense probably damaging 1.00
IGL00917:Adgrl3 APN 5 81693574 missense possibly damaging 0.93
IGL01155:Adgrl3 APN 5 81560893 missense probably benign 0.39
IGL01348:Adgrl3 APN 5 81726723 missense probably damaging 1.00
IGL01401:Adgrl3 APN 5 81688669 missense possibly damaging 0.94
IGL01443:Adgrl3 APN 5 81465287 missense probably damaging 1.00
IGL01532:Adgrl3 APN 5 81694569 missense probably damaging 1.00
IGL01779:Adgrl3 APN 5 81387870 missense probably damaging 1.00
IGL01920:Adgrl3 APN 5 81465296 missense probably damaging 1.00
IGL02065:Adgrl3 APN 5 81512217 missense probably damaging 1.00
IGL02365:Adgrl3 APN 5 81512581 missense probably damaging 1.00
IGL02879:Adgrl3 APN 5 81512119 missense probably damaging 1.00
R0010:Adgrl3 UTSW 5 81792403 missense possibly damaging 0.58
R0077:Adgrl3 UTSW 5 81771685 splice site probably benign
R0103:Adgrl3 UTSW 5 81792347 intron probably benign
R0138:Adgrl3 UTSW 5 81693607 missense probably damaging 1.00
R0149:Adgrl3 UTSW 5 81760697 missense probably damaging 1.00
R0349:Adgrl3 UTSW 5 81771644 missense probably damaging 1.00
R0361:Adgrl3 UTSW 5 81760697 missense probably damaging 1.00
R0522:Adgrl3 UTSW 5 81726801 missense possibly damaging 0.91
R0610:Adgrl3 UTSW 5 81693716 splice site probably benign
R0658:Adgrl3 UTSW 5 81648713 missense probably benign 0.18
R0671:Adgrl3 UTSW 5 81560905 missense probably benign 0.45
R0679:Adgrl3 UTSW 5 81794977 missense probably damaging 1.00
R1413:Adgrl3 UTSW 5 81693519 missense probably damaging 1.00
R1444:Adgrl3 UTSW 5 81512353 missense probably damaging 1.00
R1574:Adgrl3 UTSW 5 81787449 missense probably damaging 1.00
R1574:Adgrl3 UTSW 5 81787449 missense probably damaging 1.00
R1738:Adgrl3 UTSW 5 81387979 missense probably damaging 0.99
R1744:Adgrl3 UTSW 5 81794420 missense probably damaging 1.00
R1803:Adgrl3 UTSW 5 81771617 nonsense probably null
R1891:Adgrl3 UTSW 5 81512044 missense probably damaging 1.00
R1988:Adgrl3 UTSW 5 81688567 missense probably damaging 1.00
R2126:Adgrl3 UTSW 5 81512536 missense probably damaging 1.00
R2136:Adgrl3 UTSW 5 81512254 missense probably damaging 1.00
R2171:Adgrl3 UTSW 5 81512515 nonsense probably null
R2891:Adgrl3 UTSW 5 81693519 missense probably damaging 1.00
R3508:Adgrl3 UTSW 5 81724256 missense probably damaging 1.00
R3732:Adgrl3 UTSW 5 81794946 missense probably benign 0.05
R3732:Adgrl3 UTSW 5 81794946 missense probably benign 0.05
R3733:Adgrl3 UTSW 5 81794946 missense probably benign 0.05
R3982:Adgrl3 UTSW 5 81694526 missense possibly damaging 0.95
R4085:Adgrl3 UTSW 5 81512544 missense probably benign 0.02
R4462:Adgrl3 UTSW 5 81688510 missense probably damaging 1.00
R4725:Adgrl3 UTSW 5 81766205 missense possibly damaging 0.67
R4726:Adgrl3 UTSW 5 81646578 missense possibly damaging 0.61
R4781:Adgrl3 UTSW 5 81760724 missense probably damaging 1.00
R4837:Adgrl3 UTSW 5 81766234 missense probably benign 0.07
R4841:Adgrl3 UTSW 5 81794271 missense possibly damaging 0.53
R4883:Adgrl3 UTSW 5 81689646 missense probably damaging 1.00
R4921:Adgrl3 UTSW 5 81512110 missense probably damaging 1.00
R4945:Adgrl3 UTSW 5 81512048 missense probably damaging 1.00
R5055:Adgrl3 UTSW 5 81646551 missense possibly damaging 0.48
R5313:Adgrl3 UTSW 5 81726669 missense probably damaging 1.00
R5385:Adgrl3 UTSW 5 81726801 missense probably damaging 1.00
R5447:Adgrl3 UTSW 5 81465341 intron probably benign
R5482:Adgrl3 UTSW 5 81794513 missense probably damaging 1.00
R5586:Adgrl3 UTSW 5 81724147 missense probably damaging 0.99
R5637:Adgrl3 UTSW 5 81693544 missense probably damaging 1.00
R5919:Adgrl3 UTSW 5 81646570 missense probably benign 0.00
R6090:Adgrl3 UTSW 5 81512326 missense probably damaging 1.00
R6093:Adgrl3 UTSW 5 81646522 missense probably benign 0.42
R6107:Adgrl3 UTSW 5 81688563 missense probably damaging 0.97
R6245:Adgrl3 UTSW 5 81688556 missense probably benign 0.01
R6426:Adgrl3 UTSW 5 81726870 missense probably damaging 1.00
R6440:Adgrl3 UTSW 5 81794494 nonsense probably null
R6516:Adgrl3 UTSW 5 81465272 missense probably damaging 1.00
R6527:Adgrl3 UTSW 5 81787517 missense probably damaging 0.99
R6622:Adgrl3 UTSW 5 81794759 missense probably benign 0.34
R6842:Adgrl3 UTSW 5 81741080 missense probably damaging 1.00
R6921:Adgrl3 UTSW 5 81648713 missense probably damaging 0.99
R7201:Adgrl3 UTSW 5 81724222 missense probably damaging 1.00
R7207:Adgrl3 UTSW 5 81310027 start codon destroyed probably null 0.33
R7215:Adgrl3 UTSW 5 81693550 missense probably damaging 1.00
R7376:Adgrl3 UTSW 5 81794750 missense probably damaging 1.00
R7441:Adgrl3 UTSW 5 81724140 missense possibly damaging 0.70
R7582:Adgrl3 UTSW 5 81693676 missense probably damaging 0.99
R7682:Adgrl3 UTSW 5 81794560 missense probably damaging 0.97
Z1088:Adgrl3 UTSW 5 81329882 missense probably benign 0.33
Z1088:Adgrl3 UTSW 5 81512158 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGATGATGTTAGTGCTTAGAAC -3'
(R):5'- TGGTGAAGCTAGGAATATGCTTTC -3'

Sequencing Primer
(F):5'- AAAAAGTATTAGGGCTTGGACTTG -3'
(R):5'- AGCTAGGAATATGCTTTCTTTATGG -3'
Posted On2018-11-06