Incidental Mutation 'R6902:Tas2r117'
ID538585
Institutional Source Beutler Lab
Gene Symbol Tas2r117
Ensembl Gene ENSMUSG00000058349
Gene Nametaste receptor, type 2, member 117
SynonymsTas2r17, T2R17, mt2r54, mGR17
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R6902 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location132802818-132803975 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 132803325 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 142 (L142S)
Ref Sequence ENSEMBL: ENSMUSP00000069768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068302]
Predicted Effect probably damaging
Transcript: ENSMUST00000068302
AA Change: L142S

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000069768
Gene: ENSMUSG00000058349
AA Change: L142S

DomainStartEndE-ValueType
Pfam:TAS2R 8 307 1.2e-85 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.6%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik C G 13: 119,488,144 probably benign Het
9530053A07Rik C T 7: 28,137,213 R186C probably damaging Het
Abcc9 T A 6: 142,679,227 S481C probably damaging Het
Adgrl3 C A 5: 81,689,587 S773R probably damaging Het
Alkbh5 G A 11: 60,538,555 A45T probably benign Het
Ankrd6 C A 4: 32,806,419 Q576H probably damaging Het
Ankrd6 T A 4: 32,806,420 Q576L probably damaging Het
Carmil1 T C 13: 24,115,545 N332S possibly damaging Het
Cc2d2b A G 19: 40,816,289 Q1250R possibly damaging Het
Chd9 A C 8: 91,042,951 N2539T probably damaging Het
Clec4b2 C T 6: 123,201,028 Q101* probably null Het
Clstn2 A T 9: 97,469,822 F517I probably damaging Het
Cog2 A G 8: 124,546,691 K590E probably damaging Het
Coq9 G A 8: 94,850,552 E182K probably benign Het
Focad C T 4: 88,230,476 R477C unknown Het
Gja10 G T 4: 32,601,905 H160N probably damaging Het
Gm1673 G A 5: 33,983,579 probably benign Het
Gpr132 T A 12: 112,852,210 Y332F probably benign Het
Herc2 A G 7: 56,135,486 T1495A probably benign Het
Hivep3 T A 4: 120,095,995 S503T possibly damaging Het
Ifi44 A T 3: 151,745,899 I190N possibly damaging Het
Igf1r T A 7: 68,004,163 C150S probably damaging Het
Ighv1-42 T A 12: 114,937,535 N4Y possibly damaging Het
Klra9 T A 6: 130,179,040 I251F probably benign Het
Krt79 T C 15: 101,931,879 N294S probably benign Het
Lama2 T G 10: 26,981,629 T3075P probably damaging Het
Lrfn1 T G 7: 28,459,813 C386G probably benign Het
Lrp2 T C 2: 69,459,503 D3664G probably damaging Het
Mfsd3 T A 15: 76,703,149 M344K probably damaging Het
Mier2 C A 10: 79,540,839 probably benign Het
Mmp2 G A 8: 92,836,917 V340M probably damaging Het
Mrgprb3 T A 7: 48,643,699 I35F probably benign Het
Myo5b A T 18: 74,676,685 I613F possibly damaging Het
Olfr299 T A 7: 86,465,787 C125* probably null Het
Olfr585 A T 7: 103,098,355 I205F probably benign Het
Olfr867 A T 9: 20,055,374 L30M possibly damaging Het
Olfr948 C A 9: 39,319,019 L198F probably damaging Het
Pan2 A G 10: 128,315,637 T867A probably benign Het
Papolb T A 5: 142,528,151 H579L probably benign Het
Pcf11 C A 7: 92,658,299 G887V probably damaging Het
Pdzd8 A G 19: 59,301,397 S524P possibly damaging Het
Pole3 T C 4: 62,524,063 probably benign Het
Prdm14 C T 1: 13,122,421 V365I probably benign Het
Shank1 T A 7: 44,356,815 F1985L probably benign Het
Slc13a1 T C 6: 24,097,666 I421V possibly damaging Het
Slc2a6 C T 2: 27,023,160 V374M probably benign Het
Spata1 A T 3: 146,475,323 N293K possibly damaging Het
Stk40 T A 4: 126,137,812 D366E probably benign Het
Tcrg-V1 T C 13: 19,340,020 L2P probably benign Het
Tomm70a T C 16: 57,138,081 S266P probably damaging Het
Vipr2 A T 12: 116,139,199 T310S possibly damaging Het
Vti1a A T 19: 55,499,241 probably null Het
Zfp961 A G 8: 71,968,678 K345R probably damaging Het
Other mutations in Tas2r117
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01611:Tas2r117 APN 6 132803484 missense probably benign 0.00
IGL01611:Tas2r117 APN 6 132803487 missense probably damaging 0.96
IGL02140:Tas2r117 APN 6 132803595 missense probably benign 0.15
IGL02154:Tas2r117 APN 6 132803715 missense probably benign 0.00
IGL02466:Tas2r117 APN 6 132803000 missense probably benign 0.12
IGL02942:Tas2r117 APN 6 132803694 missense probably benign 0.00
IGL03328:Tas2r117 APN 6 132803078 missense probably benign 0.40
PIT4480001:Tas2r117 UTSW 6 132803051 missense possibly damaging 0.91
R0380:Tas2r117 UTSW 6 132803588 nonsense probably null
R0456:Tas2r117 UTSW 6 132803391 missense probably benign 0.12
R0699:Tas2r117 UTSW 6 132803198 missense probably damaging 1.00
R2118:Tas2r117 UTSW 6 132803166 missense probably damaging 0.96
R2265:Tas2r117 UTSW 6 132803225 missense probably benign 0.06
R4420:Tas2r117 UTSW 6 132803349 nonsense probably null
R4861:Tas2r117 UTSW 6 132803129 missense probably benign 0.00
R4861:Tas2r117 UTSW 6 132803129 missense probably benign 0.00
R5233:Tas2r117 UTSW 6 132803622 missense possibly damaging 0.95
R5384:Tas2r117 UTSW 6 132803154 missense probably benign 0.04
R6750:Tas2r117 UTSW 6 132802854 start gained probably benign
R6852:Tas2r117 UTSW 6 132802929 missense probably benign 0.00
R6946:Tas2r117 UTSW 6 132803325 missense probably damaging 0.98
R7129:Tas2r117 UTSW 6 132803387 missense probably benign 0.01
R7412:Tas2r117 UTSW 6 132803229 missense probably damaging 1.00
R7733:Tas2r117 UTSW 6 132803175 missense probably benign 0.02
R7768:Tas2r117 UTSW 6 132803522 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTCCTGGTCCACTGTATG -3'
(R):5'- TGTGATGTGTCCACAGGGAG -3'

Sequencing Primer
(F):5'- TGTCAATCTCCAGAATTTTTCAGC -3'
(R):5'- TGTGTCCACAGGGAGAAGATG -3'
Posted On2018-11-06