Incidental Mutation 'R6902:Zfp961'
ID538596
Institutional Source Beutler Lab
Gene Symbol Zfp961
Ensembl Gene ENSMUSG00000052446
Gene Namezinc finger protein 961
SynonymsA230105L22Rik, BC049349
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6902 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location71951038-71993792 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71968678 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 345 (K345R)
Ref Sequence ENSEMBL: ENSMUSP00000105623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109997] [ENSMUST00000131237] [ENSMUST00000132848] [ENSMUST00000136516] [ENSMUST00000138304] [ENSMUST00000145256]
Predicted Effect probably damaging
Transcript: ENSMUST00000109997
AA Change: K345R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105623
Gene: ENSMUSG00000052446
AA Change: K345R

DomainStartEndE-ValueType
KRAB 25 82 1.14e-18 SMART
ZnF_C2H2 144 166 1.69e-3 SMART
ZnF_C2H2 172 194 3.07e-1 SMART
ZnF_C2H2 199 221 1.36e-2 SMART
ZnF_C2H2 226 248 3.29e-1 SMART
ZnF_C2H2 254 276 3.34e-2 SMART
ZnF_C2H2 282 304 9.58e-3 SMART
ZnF_C2H2 310 332 2.17e-1 SMART
ZnF_C2H2 338 360 1.04e-3 SMART
ZnF_C2H2 366 388 2.24e-3 SMART
ZnF_C2H2 394 416 2.24e-3 SMART
ZnF_C2H2 421 443 4.61e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000131237
AA Change: K326R

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122942
Gene: ENSMUSG00000052446
AA Change: K326R

DomainStartEndE-ValueType
KRAB 6 63 1.14e-18 SMART
ZnF_C2H2 125 147 1.69e-3 SMART
ZnF_C2H2 153 175 3.07e-1 SMART
ZnF_C2H2 180 202 1.36e-2 SMART
ZnF_C2H2 207 229 3.29e-1 SMART
ZnF_C2H2 235 257 3.34e-2 SMART
ZnF_C2H2 263 285 9.58e-3 SMART
ZnF_C2H2 291 313 2.17e-1 SMART
ZnF_C2H2 319 341 1.04e-3 SMART
ZnF_C2H2 347 369 2.24e-3 SMART
ZnF_C2H2 375 397 2.24e-3 SMART
ZnF_C2H2 402 424 4.61e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132848
SMART Domains Protein: ENSMUSP00000114730
Gene: ENSMUSG00000052446

DomainStartEndE-ValueType
KRAB 25 82 1.14e-18 SMART
ZnF_C2H2 144 166 1.69e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136516
SMART Domains Protein: ENSMUSP00000122589
Gene: ENSMUSG00000052446

DomainStartEndE-ValueType
KRAB 25 82 1.14e-18 SMART
ZnF_C2H2 144 166 1.69e-3 SMART
ZnF_C2H2 172 194 3.07e-1 SMART
ZnF_C2H2 199 221 1.36e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138304
Predicted Effect probably benign
Transcript: ENSMUST00000145256
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.6%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik C G 13: 119,488,144 probably benign Het
9530053A07Rik C T 7: 28,137,213 R186C probably damaging Het
Abcc9 T A 6: 142,679,227 S481C probably damaging Het
Adgrl3 C A 5: 81,689,587 S773R probably damaging Het
Alkbh5 G A 11: 60,538,555 A45T probably benign Het
Ankrd6 C A 4: 32,806,419 Q576H probably damaging Het
Ankrd6 T A 4: 32,806,420 Q576L probably damaging Het
Carmil1 T C 13: 24,115,545 N332S possibly damaging Het
Cc2d2b A G 19: 40,816,289 Q1250R possibly damaging Het
Chd9 A C 8: 91,042,951 N2539T probably damaging Het
Clec4b2 C T 6: 123,201,028 Q101* probably null Het
Clstn2 A T 9: 97,469,822 F517I probably damaging Het
Cog2 A G 8: 124,546,691 K590E probably damaging Het
Coq9 G A 8: 94,850,552 E182K probably benign Het
Focad C T 4: 88,230,476 R477C unknown Het
Gja10 G T 4: 32,601,905 H160N probably damaging Het
Gm1673 G A 5: 33,983,579 probably benign Het
Gpr132 T A 12: 112,852,210 Y332F probably benign Het
Herc2 A G 7: 56,135,486 T1495A probably benign Het
Hivep3 T A 4: 120,095,995 S503T possibly damaging Het
Ifi44 A T 3: 151,745,899 I190N possibly damaging Het
Igf1r T A 7: 68,004,163 C150S probably damaging Het
Ighv1-42 T A 12: 114,937,535 N4Y possibly damaging Het
Klra9 T A 6: 130,179,040 I251F probably benign Het
Krt79 T C 15: 101,931,879 N294S probably benign Het
Lama2 T G 10: 26,981,629 T3075P probably damaging Het
Lrfn1 T G 7: 28,459,813 C386G probably benign Het
Lrp2 T C 2: 69,459,503 D3664G probably damaging Het
Mfsd3 T A 15: 76,703,149 M344K probably damaging Het
Mier2 C A 10: 79,540,839 probably benign Het
Mmp2 G A 8: 92,836,917 V340M probably damaging Het
Mrgprb3 T A 7: 48,643,699 I35F probably benign Het
Myo5b A T 18: 74,676,685 I613F possibly damaging Het
Olfr299 T A 7: 86,465,787 C125* probably null Het
Olfr585 A T 7: 103,098,355 I205F probably benign Het
Olfr867 A T 9: 20,055,374 L30M possibly damaging Het
Olfr948 C A 9: 39,319,019 L198F probably damaging Het
Pan2 A G 10: 128,315,637 T867A probably benign Het
Papolb T A 5: 142,528,151 H579L probably benign Het
Pcf11 C A 7: 92,658,299 G887V probably damaging Het
Pdzd8 A G 19: 59,301,397 S524P possibly damaging Het
Pole3 T C 4: 62,524,063 probably benign Het
Prdm14 C T 1: 13,122,421 V365I probably benign Het
Shank1 T A 7: 44,356,815 F1985L probably benign Het
Slc13a1 T C 6: 24,097,666 I421V possibly damaging Het
Slc2a6 C T 2: 27,023,160 V374M probably benign Het
Spata1 A T 3: 146,475,323 N293K possibly damaging Het
Stk40 T A 4: 126,137,812 D366E probably benign Het
Tas2r117 T C 6: 132,803,325 L142S probably damaging Het
Tcrg-V1 T C 13: 19,340,020 L2P probably benign Het
Tomm70a T C 16: 57,138,081 S266P probably damaging Het
Vipr2 A T 12: 116,139,199 T310S possibly damaging Het
Vti1a A T 19: 55,499,241 probably null Het
Other mutations in Zfp961
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Zfp961 APN 8 71968428 missense probably damaging 1.00
IGL00801:Zfp961 APN 8 71965888 missense probably damaging 1.00
IGL00825:Zfp961 APN 8 71968044 missense possibly damaging 0.91
IGL01405:Zfp961 APN 8 71967934 missense possibly damaging 0.53
IGL03100:Zfp961 APN 8 71967910 makesense probably null
R0969:Zfp961 UTSW 8 71968295 missense probably damaging 1.00
R4851:Zfp961 UTSW 8 71969003 unclassified probably benign
R5502:Zfp961 UTSW 8 71968059 missense probably damaging 0.99
R5813:Zfp961 UTSW 8 71968226 missense probably damaging 1.00
R6762:Zfp961 UTSW 8 71966114 missense possibly damaging 0.53
R7858:Zfp961 UTSW 8 71951105 missense unknown
R7941:Zfp961 UTSW 8 71951105 missense unknown
X0027:Zfp961 UTSW 8 71967949 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGTAGAGAAGCGTTCCCTAATG -3'
(R):5'- GGAGCTAGAATGTGTAGAGCTC -3'

Sequencing Primer
(F):5'- CTCACACTGGGGAGAAACCTTTTG -3'
(R):5'- GTAACTGGAACAACTAAAGGCTTTCC -3'
Posted On2018-11-06