Incidental Mutation 'R6902:Mmp2'
ID538598
Institutional Source Beutler Lab
Gene Symbol Mmp2
Ensembl Gene ENSMUSG00000031740
Gene Namematrix metallopeptidase 2
Synonymsgelatinase A, 72kDa gelatinase, Clg4a, GelA, MMP-2, 72kDa type IV collagenase
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.398) question?
Stock #R6902 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location92827291-92853420 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 92836917 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 340 (V340M)
Ref Sequence ENSEMBL: ENSMUSP00000034187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034187]
Predicted Effect probably damaging
Transcript: ENSMUST00000034187
AA Change: V340M

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034187
Gene: ENSMUSG00000031740
AA Change: V340M

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:PG_binding_1 43 97 2.4e-9 PFAM
ZnMc 115 447 1.06e-49 SMART
FN2 226 274 2.88e-25 SMART
FN2 284 332 5.17e-27 SMART
FN2 342 390 3.33e-30 SMART
HX 477 520 1.13e-4 SMART
HX 522 565 1.33e-10 SMART
HX 570 617 2.21e-16 SMART
HX 619 662 4.29e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.6%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme that hydrolyzes collagens, gelatins, laminin, fibronectin and elastin. Mice lacking the encoded protein exhibit suppressed angiogenesis and attenuated features of human multicentric osteolysis with arthritis including abnormal skeletal and craniofacial development. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit slightly delayed growth, reduced neovascularization, retarded tumor progression, an exaggerated asthma response to allergens, and impaired branching morphogenesis of the mammary gland. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik C G 13: 119,488,144 probably benign Het
9530053A07Rik C T 7: 28,137,213 R186C probably damaging Het
Abcc9 T A 6: 142,679,227 S481C probably damaging Het
Adgrl3 C A 5: 81,689,587 S773R probably damaging Het
Alkbh5 G A 11: 60,538,555 A45T probably benign Het
Ankrd6 C A 4: 32,806,419 Q576H probably damaging Het
Ankrd6 T A 4: 32,806,420 Q576L probably damaging Het
Carmil1 T C 13: 24,115,545 N332S possibly damaging Het
Cc2d2b A G 19: 40,816,289 Q1250R possibly damaging Het
Chd9 A C 8: 91,042,951 N2539T probably damaging Het
Clec4b2 C T 6: 123,201,028 Q101* probably null Het
Clstn2 A T 9: 97,469,822 F517I probably damaging Het
Cog2 A G 8: 124,546,691 K590E probably damaging Het
Coq9 G A 8: 94,850,552 E182K probably benign Het
Focad C T 4: 88,230,476 R477C unknown Het
Gja10 G T 4: 32,601,905 H160N probably damaging Het
Gm1673 G A 5: 33,983,579 probably benign Het
Gpr132 T A 12: 112,852,210 Y332F probably benign Het
Herc2 A G 7: 56,135,486 T1495A probably benign Het
Hivep3 T A 4: 120,095,995 S503T possibly damaging Het
Ifi44 A T 3: 151,745,899 I190N possibly damaging Het
Igf1r T A 7: 68,004,163 C150S probably damaging Het
Ighv1-42 T A 12: 114,937,535 N4Y possibly damaging Het
Klra9 T A 6: 130,179,040 I251F probably benign Het
Krt79 T C 15: 101,931,879 N294S probably benign Het
Lama2 T G 10: 26,981,629 T3075P probably damaging Het
Lrfn1 T G 7: 28,459,813 C386G probably benign Het
Lrp2 T C 2: 69,459,503 D3664G probably damaging Het
Mfsd3 T A 15: 76,703,149 M344K probably damaging Het
Mier2 C A 10: 79,540,839 probably benign Het
Mrgprb3 T A 7: 48,643,699 I35F probably benign Het
Myo5b A T 18: 74,676,685 I613F possibly damaging Het
Olfr299 T A 7: 86,465,787 C125* probably null Het
Olfr585 A T 7: 103,098,355 I205F probably benign Het
Olfr867 A T 9: 20,055,374 L30M possibly damaging Het
Olfr948 C A 9: 39,319,019 L198F probably damaging Het
Pan2 A G 10: 128,315,637 T867A probably benign Het
Papolb T A 5: 142,528,151 H579L probably benign Het
Pcf11 C A 7: 92,658,299 G887V probably damaging Het
Pdzd8 A G 19: 59,301,397 S524P possibly damaging Het
Pole3 T C 4: 62,524,063 probably benign Het
Prdm14 C T 1: 13,122,421 V365I probably benign Het
Shank1 T A 7: 44,356,815 F1985L probably benign Het
Slc13a1 T C 6: 24,097,666 I421V possibly damaging Het
Slc2a6 C T 2: 27,023,160 V374M probably benign Het
Spata1 A T 3: 146,475,323 N293K possibly damaging Het
Stk40 T A 4: 126,137,812 D366E probably benign Het
Tas2r117 T C 6: 132,803,325 L142S probably damaging Het
Tcrg-V1 T C 13: 19,340,020 L2P probably benign Het
Tomm70a T C 16: 57,138,081 S266P probably damaging Het
Vipr2 A T 12: 116,139,199 T310S possibly damaging Het
Vti1a A T 19: 55,499,241 probably null Het
Zfp961 A G 8: 71,968,678 K345R probably damaging Het
Other mutations in Mmp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00647:Mmp2 APN 8 92830684 missense probably benign
IGL02165:Mmp2 APN 8 92833219 missense probably null 1.00
IGL02424:Mmp2 APN 8 92836007 missense probably damaging 1.00
IGL02478:Mmp2 APN 8 92852607 missense possibly damaging 0.50
IGL03351:Mmp2 APN 8 92839342 missense probably benign 0.00
R2012:Mmp2 UTSW 8 92850203 missense probably benign 0.00
R2034:Mmp2 UTSW 8 92836912 missense probably damaging 1.00
R2079:Mmp2 UTSW 8 92850189 missense probably damaging 1.00
R5090:Mmp2 UTSW 8 92852574 missense probably damaging 1.00
R5103:Mmp2 UTSW 8 92831785 nonsense probably null
R5357:Mmp2 UTSW 8 92833152 missense possibly damaging 0.73
R6925:Mmp2 UTSW 8 92839382 missense probably damaging 1.00
R7057:Mmp2 UTSW 8 92831705 missense probably damaging 1.00
R7229:Mmp2 UTSW 8 92831786 missense probably damaging 1.00
R7316:Mmp2 UTSW 8 92840410 missense probably benign
R7332:Mmp2 UTSW 8 92850152 missense probably damaging 1.00
R7397:Mmp2 UTSW 8 92836127 missense possibly damaging 0.91
R7549:Mmp2 UTSW 8 92836966 missense probably null 1.00
R7585:Mmp2 UTSW 8 92836936 missense probably damaging 1.00
R7694:Mmp2 UTSW 8 92831730 missense possibly damaging 0.76
R7814:Mmp2 UTSW 8 92850170 missense probably benign 0.03
X0065:Mmp2 UTSW 8 92827739 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTCCTATCTACAAGGGTCC -3'
(R):5'- AGTGTCTCTACCCAAAGGCCAG -3'

Sequencing Primer
(F):5'- AGACTCTGAACTATGGCTACCTGG -3'
(R):5'- AGGGCCTCATACCTTGGTCAG -3'
Posted On2018-11-06