Mutagenetix > Incidental Mutation

Incidental Mutation 'R6902:Cog2'

538600

Institutional Source

Beutler Lab

Gene Symbol

Cog2

Ensembl Gene

ENSMUSG00000031979

Gene Name

component of oligomeric golgi complex 2

Synonyms

2700012E02Rik, 1190002B08Rik, Cog2

MMRRC Submission

045032-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6902 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

124520767-124552008 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 124546691 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 590 (K590E)

Ref Sequence

ENSEMBL: ENSMUSP00000034460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034460]

AlphaFold

Q921L5

Predicted Effect

probably damaging
Transcript: ENSMUST00000034460
AA Change: K590E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000034460
Gene: ENSMUSG00000031979
AA Change: K590E

Domain	Start	End	E-Value	Type
Pfam:COG2	15	147	1.4e-44	PFAM
low complexity region	207	220	N/A	INTRINSIC
low complexity region	490	502	N/A	INTRINSIC
Pfam:DUF3510	565	692	6.1e-45	PFAM

Meta Mutation Damage Score

0.3984

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.6%

Validation Efficiency

98% (50/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi complex. The encoded protein specifically interacts with the USO1 vesicle docking protein and may be necessary for normal Golgi ribbon formation and trafficking of Golgi enzymes. Mutations of this gene are associated with abnormal glycosylation within the Golgi apparatus. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110070M22Rik	C	G	13: 119,488,144		probably benign	Het
9530053A07Rik	C	T	7: 28,137,213	R186C	probably damaging	Het
Abcc9	T	A	6: 142,679,227	S481C	probably damaging	Het
Adgrl3	C	A	5: 81,689,587	S773R	probably damaging	Het
Alkbh5	G	A	11: 60,538,555	A45T	probably benign	Het
Ankrd6	C	A	4: 32,806,419	Q576H	probably damaging	Het
Ankrd6	T	A	4: 32,806,420	Q576L	probably damaging	Het
Carmil1	T	C	13: 24,115,545	N332S	possibly damaging	Het
Cc2d2b	A	G	19: 40,816,289	Q1250R	possibly damaging	Het
Chd9	A	C	8: 91,042,951	N2539T	probably damaging	Het
Clec4b2	C	T	6: 123,201,028	Q101*	probably null	Het
Clstn2	A	T	9: 97,469,822	F517I	probably damaging	Het
Coq9	G	A	8: 94,850,552	E182K	probably benign	Het
Focad	C	T	4: 88,230,476	R477C	unknown	Het
Gja10	G	T	4: 32,601,905	H160N	probably damaging	Het
Gm1673	G	A	5: 33,983,579		probably benign	Het
Gpr132	T	A	12: 112,852,210	Y332F	probably benign	Het
Herc2	A	G	7: 56,135,486	T1495A	probably benign	Het
Hivep3	T	A	4: 120,095,995	S503T	possibly damaging	Het
Ifi44	A	T	3: 151,745,899	I190N	possibly damaging	Het
Igf1r	T	A	7: 68,004,163	C150S	probably damaging	Het
Ighv1-42	T	A	12: 114,937,535	N4Y	possibly damaging	Het
Klra9	T	A	6: 130,179,040	I251F	probably benign	Het
Krt79	T	C	15: 101,931,879	N294S	probably benign	Het
Lama2	T	G	10: 26,981,629	T3075P	probably damaging	Het
Lrfn1	T	G	7: 28,459,813	C386G	probably benign	Het
Lrp2	T	C	2: 69,459,503	D3664G	probably damaging	Het
Mfsd3	T	A	15: 76,703,149	M344K	probably damaging	Het
Mier2	C	A	10: 79,540,839		probably benign	Het
Mmp2	G	A	8: 92,836,917	V340M	probably damaging	Het
Mrgprb3	T	A	7: 48,643,699	I35F	probably benign	Het
Myo5b	A	T	18: 74,676,685	I613F	possibly damaging	Het
Olfr299	T	A	7: 86,465,787	C125*	probably null	Het
Olfr585	A	T	7: 103,098,355	I205F	probably benign	Het
Olfr867	A	T	9: 20,055,374	L30M	possibly damaging	Het
Olfr948	C	A	9: 39,319,019	L198F	probably damaging	Het
Pan2	A	G	10: 128,315,637	T867A	probably benign	Het
Papolb	T	A	5: 142,528,151	H579L	probably benign	Het
Pcf11	C	A	7: 92,658,299	G887V	probably damaging	Het
Pdzd8	A	G	19: 59,301,397	S524P	possibly damaging	Het
Pole3	T	C	4: 62,524,063		probably benign	Het
Prdm14	C	T	1: 13,122,421	V365I	probably benign	Het
Shank1	T	A	7: 44,356,815	F1985L	probably benign	Het
Slc13a1	T	C	6: 24,097,666	I421V	possibly damaging	Het
Slc2a6	C	T	2: 27,023,160	V374M	probably benign	Het
Spata1	A	T	3: 146,475,323	N293K	possibly damaging	Het
Stk40	T	A	4: 126,137,812	D366E	probably benign	Het
Tas2r117	T	C	6: 132,803,325	L142S	probably damaging	Het
Tcrg-V1	T	C	13: 19,340,020	L2P	probably benign	Het
Tomm70a	T	C	16: 57,138,081	S266P	probably damaging	Het
Vipr2	A	T	12: 116,139,199	T310S	possibly damaging	Het
Vti1a	A	T	19: 55,499,241		probably null	Het
Zfp961	A	G	8: 71,968,678	K345R	probably damaging	Het

Other mutations in Cog2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01089:Cog2	APN	8	124545243	missense	probably benign	0.00
IGL01092:Cog2	APN	8	124545280	missense	probably damaging	1.00
IGL01150:Cog2	APN	8	124542891	missense	possibly damaging	0.62
IGL02052:Cog2	APN	8	124542888	critical splice acceptor site	probably null
IGL02308:Cog2	APN	8	124533212	critical splice acceptor site	probably null
IGL02543:Cog2	APN	8	124529959	missense	probably benign	0.09
IGL02978:Cog2	APN	8	124550336	missense	probably benign
IGL03008:Cog2	APN	8	124535392	splice site	probably benign
IGL03144:Cog2	APN	8	124541024	missense	probably damaging	0.98
kugge	UTSW	8	124550232	missense	probably damaging	1.00
Pelota	UTSW	8	124550306	missense	probably damaging	1.00
PIT4677001:Cog2	UTSW	8	124545271	missense	probably benign	0.22
R0071:Cog2	UTSW	8	124548668	splice site	probably benign
R0071:Cog2	UTSW	8	124548668	splice site	probably benign
R0110:Cog2	UTSW	8	124529058	critical splice donor site	probably null
R0436:Cog2	UTSW	8	124548514	splice site	probably benign
R0450:Cog2	UTSW	8	124529058	critical splice donor site	probably null
R1365:Cog2	UTSW	8	124540974	missense	probably damaging	0.97
R1661:Cog2	UTSW	8	124542890	missense	probably benign	0.20
R1698:Cog2	UTSW	8	124525683	missense	probably damaging	1.00
R1856:Cog2	UTSW	8	124551403	missense	possibly damaging	0.93
R2122:Cog2	UTSW	8	124528985	missense	possibly damaging	0.91
R2398:Cog2	UTSW	8	124529926	missense	probably benign	0.07
R3855:Cog2	UTSW	8	124530003	critical splice donor site	probably null
R4580:Cog2	UTSW	8	124545136	missense	probably benign	0.01
R4803:Cog2	UTSW	8	124535451	missense	probably damaging	0.96
R5316:Cog2	UTSW	8	124529040	missense	probably benign	0.14
R5346:Cog2	UTSW	8	124546631	missense	possibly damaging	0.94
R5394:Cog2	UTSW	8	124532529	missense	probably benign	0.00
R5395:Cog2	UTSW	8	124545221	missense	probably benign	0.00
R5738:Cog2	UTSW	8	124546038	missense	probably benign	0.03
R5861:Cog2	UTSW	8	124537878	missense	probably damaging	1.00
R5894:Cog2	UTSW	8	124545267	missense	probably benign	0.00
R5941:Cog2	UTSW	8	124546086	missense	probably benign
R6186:Cog2	UTSW	8	124546686	missense	probably damaging	1.00
R6400:Cog2	UTSW	8	124550306	missense	probably damaging	1.00
R6518:Cog2	UTSW	8	124527103	nonsense	probably null
R6558:Cog2	UTSW	8	124550232	missense	probably damaging	1.00
R6717:Cog2	UTSW	8	124525749	missense	probably damaging	1.00
R6914:Cog2	UTSW	8	124545136	missense	probably benign	0.00
R6942:Cog2	UTSW	8	124545136	missense	probably benign	0.00
R7103:Cog2	UTSW	8	124541114	critical splice donor site	probably null
R7274:Cog2	UTSW	8	124535519	missense	possibly damaging	0.71
R7641:Cog2	UTSW	8	124537882	missense	probably damaging	0.96
R7674:Cog2	UTSW	8	124537882	missense	probably damaging	0.96
R8559:Cog2	UTSW	8	124542908	missense	probably benign	0.25
R9190:Cog2	UTSW	8	124533319	missense	probably damaging	1.00
R9307:Cog2	UTSW	8	124527098	critical splice acceptor site	probably null
R9629:Cog2	UTSW	8	124533386	missense	possibly damaging	0.67
X0026:Cog2	UTSW	8	124546020	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- CAGTGACTCATTCCACTGCC -3'
(R):5'- AGAAACACCGTGAAATCGTTCC -3'

Sequencing Primer
(F):5'- ACTGCCCTGTGTCACAGC -3'
(R):5'- TGAGTTCCAGATCAGTCAGGACTC -3'

Posted On

2018-11-06