Incidental Mutation 'R6902:Pan2'
ID538606
Institutional Source Beutler Lab
Gene Symbol Pan2
Ensembl Gene ENSMUSG00000005682
Gene NamePAN2 poly(A) specific ribonuclease subunit
SynonymsUsp52, 1200014O24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6902 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location128303335-128321358 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128315637 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 867 (T867A)
Ref Sequence ENSEMBL: ENSMUSP00000151216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005825] [ENSMUST00000218315] [ENSMUST00000219721]
Predicted Effect probably benign
Transcript: ENSMUST00000005825
AA Change: T876A

PolyPhen 2 Score 0.171 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000005825
Gene: ENSMUSG00000005682
AA Change: T876A

DomainStartEndE-ValueType
low complexity region 67 79 N/A INTRINSIC
SCOP:d1tbga_ 151 357 4e-11 SMART
Blast:WD40 225 271 4e-11 BLAST
low complexity region 412 425 N/A INTRINSIC
Pfam:UCH 515 920 2.6e-15 PFAM
Pfam:UCH_1 516 897 9.7e-70 PFAM
low complexity region 938 949 N/A INTRINSIC
EXOIII 972 1155 1.68e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218315
AA Change: T867A

PolyPhen 2 Score 0.333 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000219721
AA Change: T849A

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.6%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a deadenylase that functions as the catalytic subunit of the polyadenylate binding protein dependent poly(A) nuclease complex. The encoded protein is a magnesium dependent 3' to 5' exoribonuclease that is involved in the degradation of cytoplasmic mRNAs. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik C G 13: 119,488,144 probably benign Het
9530053A07Rik C T 7: 28,137,213 R186C probably damaging Het
Abcc9 T A 6: 142,679,227 S481C probably damaging Het
Adgrl3 C A 5: 81,689,587 S773R probably damaging Het
Alkbh5 G A 11: 60,538,555 A45T probably benign Het
Ankrd6 C A 4: 32,806,419 Q576H probably damaging Het
Ankrd6 T A 4: 32,806,420 Q576L probably damaging Het
Carmil1 T C 13: 24,115,545 N332S possibly damaging Het
Cc2d2b A G 19: 40,816,289 Q1250R possibly damaging Het
Chd9 A C 8: 91,042,951 N2539T probably damaging Het
Clec4b2 C T 6: 123,201,028 Q101* probably null Het
Clstn2 A T 9: 97,469,822 F517I probably damaging Het
Cog2 A G 8: 124,546,691 K590E probably damaging Het
Coq9 G A 8: 94,850,552 E182K probably benign Het
Focad C T 4: 88,230,476 R477C unknown Het
Gja10 G T 4: 32,601,905 H160N probably damaging Het
Gm1673 G A 5: 33,983,579 probably benign Het
Gpr132 T A 12: 112,852,210 Y332F probably benign Het
Herc2 A G 7: 56,135,486 T1495A probably benign Het
Hivep3 T A 4: 120,095,995 S503T possibly damaging Het
Ifi44 A T 3: 151,745,899 I190N possibly damaging Het
Igf1r T A 7: 68,004,163 C150S probably damaging Het
Ighv1-42 T A 12: 114,937,535 N4Y possibly damaging Het
Klra9 T A 6: 130,179,040 I251F probably benign Het
Krt79 T C 15: 101,931,879 N294S probably benign Het
Lama2 T G 10: 26,981,629 T3075P probably damaging Het
Lrfn1 T G 7: 28,459,813 C386G probably benign Het
Lrp2 T C 2: 69,459,503 D3664G probably damaging Het
Mfsd3 T A 15: 76,703,149 M344K probably damaging Het
Mier2 C A 10: 79,540,839 probably benign Het
Mmp2 G A 8: 92,836,917 V340M probably damaging Het
Mrgprb3 T A 7: 48,643,699 I35F probably benign Het
Myo5b A T 18: 74,676,685 I613F possibly damaging Het
Olfr299 T A 7: 86,465,787 C125* probably null Het
Olfr585 A T 7: 103,098,355 I205F probably benign Het
Olfr867 A T 9: 20,055,374 L30M possibly damaging Het
Olfr948 C A 9: 39,319,019 L198F probably damaging Het
Papolb T A 5: 142,528,151 H579L probably benign Het
Pcf11 C A 7: 92,658,299 G887V probably damaging Het
Pdzd8 A G 19: 59,301,397 S524P possibly damaging Het
Pole3 T C 4: 62,524,063 probably benign Het
Prdm14 C T 1: 13,122,421 V365I probably benign Het
Shank1 T A 7: 44,356,815 F1985L probably benign Het
Slc13a1 T C 6: 24,097,666 I421V possibly damaging Het
Slc2a6 C T 2: 27,023,160 V374M probably benign Het
Spata1 A T 3: 146,475,323 N293K possibly damaging Het
Stk40 T A 4: 126,137,812 D366E probably benign Het
Tas2r117 T C 6: 132,803,325 L142S probably damaging Het
Tcrg-V1 T C 13: 19,340,020 L2P probably benign Het
Tomm70a T C 16: 57,138,081 S266P probably damaging Het
Vipr2 A T 12: 116,139,199 T310S possibly damaging Het
Vti1a A T 19: 55,499,241 probably null Het
Zfp961 A G 8: 71,968,678 K345R probably damaging Het
Other mutations in Pan2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Pan2 APN 10 128312926 nonsense probably null
IGL02183:Pan2 APN 10 128309075 missense possibly damaging 0.74
IGL02219:Pan2 APN 10 128320352 missense probably benign 0.04
IGL02514:Pan2 APN 10 128310741 missense possibly damaging 0.94
IGL02552:Pan2 APN 10 128319027 missense probably damaging 1.00
IGL02623:Pan2 APN 10 128312899 missense probably benign
IGL02860:Pan2 APN 10 128310735 nonsense probably null
IGL03104:Pan2 APN 10 128315663 splice site probably benign
IGL03372:Pan2 APN 10 128315127 missense probably benign 0.09
R0541:Pan2 UTSW 10 128308222 missense possibly damaging 0.87
R0585:Pan2 UTSW 10 128310515 critical splice donor site probably null
R1079:Pan2 UTSW 10 128318238 missense probably damaging 0.99
R1650:Pan2 UTSW 10 128317899 missense probably damaging 1.00
R1847:Pan2 UTSW 10 128304378 missense possibly damaging 0.71
R1867:Pan2 UTSW 10 128313181 missense probably damaging 1.00
R1903:Pan2 UTSW 10 128308368 missense probably damaging 0.98
R1975:Pan2 UTSW 10 128320413 missense probably damaging 0.99
R1976:Pan2 UTSW 10 128320413 missense probably damaging 0.99
R1977:Pan2 UTSW 10 128320413 missense probably damaging 0.99
R2136:Pan2 UTSW 10 128313637 missense possibly damaging 0.95
R2162:Pan2 UTSW 10 128304222 missense possibly damaging 0.90
R2512:Pan2 UTSW 10 128304457 missense probably damaging 1.00
R2566:Pan2 UTSW 10 128313897 missense probably damaging 1.00
R2900:Pan2 UTSW 10 128308342 missense probably benign
R3957:Pan2 UTSW 10 128315177 missense probably damaging 0.99
R4571:Pan2 UTSW 10 128308643 missense probably benign 0.05
R5112:Pan2 UTSW 10 128315595 nonsense probably null
R5120:Pan2 UTSW 10 128314995 critical splice donor site probably null
R5183:Pan2 UTSW 10 128317969 missense probably damaging 1.00
R5325:Pan2 UTSW 10 128317634 missense possibly damaging 0.59
R5539:Pan2 UTSW 10 128308133 missense probably benign 0.16
R5642:Pan2 UTSW 10 128308100 missense probably benign 0.00
R5740:Pan2 UTSW 10 128308164 missense probably damaging 1.00
R5822:Pan2 UTSW 10 128320380 missense probably damaging 1.00
R6766:Pan2 UTSW 10 128314512 missense possibly damaging 0.79
R6946:Pan2 UTSW 10 128315637 missense probably benign 0.33
R7206:Pan2 UTSW 10 128314545 nonsense probably null
R7490:Pan2 UTSW 10 128308440 missense probably benign 0.00
R7715:Pan2 UTSW 10 128317723 missense probably benign 0.00
RF005:Pan2 UTSW 10 128315535 missense probably benign 0.00
RF024:Pan2 UTSW 10 128315535 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGGCTAAAATGGAGATACCCTAC -3'
(R):5'- GTCATTGAAGAGATACCACTGCTG -3'

Sequencing Primer
(F):5'- ATGGAGATACCCTACCCTCTG -3'
(R):5'- GATACCACTGCTGATGAGTCACG -3'
Posted On2018-11-06