Incidental Mutation 'R6903:BC034090'
ID538623
Institutional Source Beutler Lab
Gene Symbol BC034090
Ensembl Gene ENSMUSG00000033722
Gene NamecDNA sequence BC034090
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R6903 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location155212471-155244444 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 155221385 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 656 (T656A)
Ref Sequence ENSEMBL: ENSMUSP00000037456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035914] [ENSMUST00000186156] [ENSMUST00000187096]
Predicted Effect probably benign
Transcript: ENSMUST00000035914
AA Change: T656A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000037456
Gene: ENSMUSG00000033722
AA Change: T656A

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:DUF4685 44 168 6.6e-57 PFAM
low complexity region 486 500 N/A INTRINSIC
low complexity region 562 568 N/A INTRINSIC
low complexity region 640 652 N/A INTRINSIC
PDZ 830 905 4.8e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186156
AA Change: T1018A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000139623
Gene: ENSMUSG00000033722
AA Change: T1018A

DomainStartEndE-ValueType
low complexity region 446 463 N/A INTRINSIC
low complexity region 779 793 N/A INTRINSIC
low complexity region 855 861 N/A INTRINSIC
low complexity region 933 945 N/A INTRINSIC
PDZ 1123 1198 2.2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187096
SMART Domains Protein: ENSMUSP00000140632
Gene: ENSMUSG00000033722

DomainStartEndE-ValueType
low complexity region 84 101 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.3%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110034G24Rik A T 2: 132,750,644 K204* probably null Het
9530053A07Rik C T 7: 28,137,213 R186C probably damaging Het
Abca1 A T 4: 53,143,952 L15Q probably benign Het
Acsf2 T C 11: 94,559,591 M497V probably benign Het
Adnp2 T C 18: 80,130,090 N368S probably benign Het
Bsph1 A G 7: 13,458,258 Y26C probably damaging Het
Cct7 T C 6: 85,466,693 F306L probably benign Het
Cd109 A G 9: 78,636,603 Q143R probably damaging Het
Cfap46 A T 7: 139,654,561 probably null Het
Col3a1 A G 1: 45,331,988 N436D probably damaging Het
Col6a3 T C 1: 90,794,207 E1498G probably damaging Het
Cyp2u1 T C 3: 131,302,775 D118G probably benign Het
Dek A G 13: 47,098,187 S51P possibly damaging Het
Dock6 C T 9: 21,809,564 G1746D probably damaging Het
Dscam T A 16: 96,820,788 N488Y probably damaging Het
Ebpl G T 14: 61,360,244 Y49* probably null Het
Eefsec C T 6: 88,446,283 G66D probably benign Het
Epha6 T A 16: 60,526,462 Y146F probably benign Het
Frmd4a A G 2: 4,586,456 R96G probably damaging Het
Gm5814 A G 17: 47,410,427 probably benign Het
Hspa13 C G 16: 75,757,984 V405L probably damaging Het
Iqgap2 A G 13: 95,661,057 V1079A probably damaging Het
Kcnj9 C A 1: 172,326,056 R167L probably damaging Het
Kdm1b T A 13: 47,074,404 D620E probably benign Het
Kif23 T C 9: 61,927,154 R442G possibly damaging Het
Nectin1 C A 9: 43,791,882 P146T possibly damaging Het
Noc4l A G 5: 110,649,595 I391T probably damaging Het
Npr1 C A 3: 90,455,145 R956L possibly damaging Het
Olfr736 T A 14: 50,393,632 M292K possibly damaging Het
Olfr740 T A 14: 50,453,955 M301K possibly damaging Het
Pcdhgb2 T C 18: 37,692,170 V738A possibly damaging Het
Ptpn20 A G 14: 33,614,504 E100G probably damaging Het
Rgs10 A G 7: 128,389,073 F97S probably damaging Het
Shisa6 T C 11: 66,375,156 probably null Het
Sirpb1a T C 3: 15,416,924 T115A probably damaging Het
Supv3l1 A G 10: 62,441,237 C251R probably damaging Het
Svopl T C 6: 38,021,608 S244G probably benign Het
Tes T C 6: 17,099,863 Y286H probably damaging Het
Tnfrsf22 G A 7: 143,639,904 probably benign Het
Vmn1r185 A G 7: 26,611,735 I115T probably damaging Het
Vmn2r-ps117 A G 17: 18,838,290 T703A possibly damaging Het
Zan T A 5: 137,456,304 I1413L unknown Het
Zc3h12d G T 10: 7,867,661 M398I probably benign Het
Zfp219 G A 14: 52,006,661 T642M probably benign Het
Zfp646 G A 7: 127,880,720 E690K possibly damaging Het
Zfr T A 15: 12,136,455 V66D unknown Het
Other mutations in BC034090
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:BC034090 APN 1 155225447 missense possibly damaging 0.95
IGL00159:BC034090 APN 1 155225451 nonsense probably null
IGL00481:BC034090 APN 1 155232521 missense probably benign 0.04
IGL01309:BC034090 APN 1 155226384 missense probably damaging 0.98
IGL01813:BC034090 APN 1 155226339 nonsense probably null
IGL01938:BC034090 APN 1 155232592 splice site probably null
IGL01982:BC034090 APN 1 155223332 missense probably damaging 1.00
IGL02115:BC034090 APN 1 155232651 intron probably benign
IGL02338:BC034090 APN 1 155217471 missense probably damaging 1.00
IGL02406:BC034090 APN 1 155225153 missense probably benign 0.00
IGL03243:BC034090 APN 1 155225655 missense possibly damaging 0.71
IGL03290:BC034090 APN 1 155226110 missense probably damaging 1.00
BB004:BC034090 UTSW 1 155241625 nonsense probably null
BB014:BC034090 UTSW 1 155241625 nonsense probably null
R0055:BC034090 UTSW 1 155241658 missense probably damaging 1.00
R1436:BC034090 UTSW 1 155225916 missense probably benign 0.04
R1649:BC034090 UTSW 1 155225573 missense possibly damaging 0.72
R1710:BC034090 UTSW 1 155225864 missense possibly damaging 0.82
R1819:BC034090 UTSW 1 155225829 missense possibly damaging 0.58
R1969:BC034090 UTSW 1 155225226 missense possibly damaging 0.90
R1996:BC034090 UTSW 1 155221594 unclassified probably benign
R2012:BC034090 UTSW 1 155221432 missense probably damaging 0.98
R2133:BC034090 UTSW 1 155225786 missense probably benign 0.27
R3426:BC034090 UTSW 1 155241498 missense probably benign 0.00
R3427:BC034090 UTSW 1 155241498 missense probably benign 0.00
R3428:BC034090 UTSW 1 155241498 missense probably benign 0.00
R3782:BC034090 UTSW 1 155226278 missense probably damaging 1.00
R3792:BC034090 UTSW 1 155241797 missense probably damaging 0.98
R4234:BC034090 UTSW 1 155241580 missense probably benign
R4373:BC034090 UTSW 1 155226158 missense probably benign 0.22
R4377:BC034090 UTSW 1 155232450 missense probably benign 0.00
R4661:BC034090 UTSW 1 155232475 missense probably damaging 0.98
R4676:BC034090 UTSW 1 155226264 missense possibly damaging 0.60
R4729:BC034090 UTSW 1 155225090 missense probably damaging 1.00
R5170:BC034090 UTSW 1 155213650 missense probably damaging 1.00
R5340:BC034090 UTSW 1 155226414 missense possibly damaging 0.74
R5382:BC034090 UTSW 1 155225603 missense probably benign 0.09
R5384:BC034090 UTSW 1 155242027 missense possibly damaging 0.68
R5576:BC034090 UTSW 1 155241468 missense probably benign 0.01
R5891:BC034090 UTSW 1 155233047 unclassified probably benign
R6060:BC034090 UTSW 1 155241499 missense probably benign 0.00
R6092:BC034090 UTSW 1 155224913 missense probably damaging 0.99
R6662:BC034090 UTSW 1 155226339 missense possibly damaging 0.92
R6736:BC034090 UTSW 1 155241930 missense possibly damaging 0.92
R6970:BC034090 UTSW 1 155241439 missense probably damaging 1.00
R7144:BC034090 UTSW 1 155242031 missense probably damaging 1.00
R7201:BC034090 UTSW 1 155241934 missense probably damaging 0.98
R7265:BC034090 UTSW 1 155225327 missense probably damaging 0.96
R7380:BC034090 UTSW 1 155232483 missense probably damaging 1.00
R7436:BC034090 UTSW 1 155226381 missense probably damaging 1.00
R7569:BC034090 UTSW 1 155217405 missense probably benign 0.00
R7587:BC034090 UTSW 1 155217486 missense probably damaging 1.00
R7664:BC034090 UTSW 1 155241631 missense probably damaging 1.00
R7737:BC034090 UTSW 1 155241673 missense possibly damaging 0.66
R7782:BC034090 UTSW 1 155232664 intron probably benign
R7927:BC034090 UTSW 1 155241625 nonsense probably null
R8079:BC034090 UTSW 1 155225286 missense probably damaging 1.00
R8204:BC034090 UTSW 1 155241742 missense probably damaging 1.00
R8558:BC034090 UTSW 1 155221339 missense possibly damaging 0.95
R8832:BC034090 UTSW 1 155226288 missense probably damaging 1.00
R8858:BC034090 UTSW 1 155226218 missense probably benign 0.17
R8879:BC034090 UTSW 1 155226357 missense probably benign
X0002:BC034090 UTSW 1 155226279 nonsense probably null
Z1187:BC034090 UTSW 1 155241499 missense probably benign 0.00
Z1189:BC034090 UTSW 1 155241499 missense probably benign 0.00
Z1190:BC034090 UTSW 1 155241499 missense probably benign 0.00
Z1192:BC034090 UTSW 1 155241499 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACAGTCGTGAGGATGCTAG -3'
(R):5'- GATACATCCAGCTCATGCCCTC -3'

Sequencing Primer
(F):5'- TGAGGATGCTAGCGGCTC -3'
(R):5'- CGTTTCAGAGCATCACTTGAG -3'
Posted On2018-11-06