Incidental Mutation 'R6903:Sirpb1a'
ID 538627
Institutional Source Beutler Lab
Gene Symbol Sirpb1a
Ensembl Gene ENSMUSG00000095788
Gene Name signal-regulatory protein beta 1A
Synonyms 9930027N05Rik, Sirpb1
MMRRC Submission 044996-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R6903 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 15436887-15491487 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 15481984 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 115 (T115A)
Ref Sequence ENSEMBL: ENSMUSP00000141504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099201] [ENSMUST00000192700] [ENSMUST00000194144]
AlphaFold A0A0A6YYP6
Predicted Effect probably damaging
Transcript: ENSMUST00000099201
AA Change: T115A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000096807
Gene: ENSMUSG00000095788
AA Change: T115A

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
IG 37 143 2.48e-8 SMART
IGc1 163 236 1.17e-4 SMART
IGc1 269 339 4.91e-4 SMART
transmembrane domain 364 386 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192700
AA Change: T115A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141504
Gene: ENSMUSG00000095788
AA Change: T115A

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
IG 37 143 2.48e-8 SMART
IGc1 163 236 1.17e-4 SMART
IGc1 269 339 4.91e-4 SMART
transmembrane domain 364 386 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000194144
AA Change: T48A

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141659
Gene: ENSMUSG00000095788
AA Change: T48A

DomainStartEndE-ValueType
Pfam:Ig_2 15 66 6.6e-1 PFAM
Pfam:Ig_3 21 52 1.7e-2 PFAM
Pfam:V-set 23 75 1.2e-7 PFAM
IGc1 96 169 4.8e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.3%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A T 4: 53,143,952 (GRCm39) L15Q probably benign Het
Acsf2 T C 11: 94,450,417 (GRCm39) M497V probably benign Het
Adnp2 T C 18: 80,173,305 (GRCm39) N368S probably benign Het
BC034090 T C 1: 155,097,131 (GRCm39) T656A probably benign Het
Bsph1 A G 7: 13,192,183 (GRCm39) Y26C probably damaging Het
Cct7 T C 6: 85,443,675 (GRCm39) F306L probably benign Het
Cd109 A G 9: 78,543,885 (GRCm39) Q143R probably damaging Het
Cfap46 A T 7: 139,234,477 (GRCm39) probably null Het
Col3a1 A G 1: 45,371,148 (GRCm39) N436D probably damaging Het
Col6a3 T C 1: 90,721,929 (GRCm39) E1498G probably damaging Het
Cyp2u1 T C 3: 131,096,424 (GRCm39) D118G probably benign Het
Dek A G 13: 47,251,663 (GRCm39) S51P possibly damaging Het
Dock6 C T 9: 21,720,860 (GRCm39) G1746D probably damaging Het
Dscam T A 16: 96,621,988 (GRCm39) N488Y probably damaging Het
Ebpl G T 14: 61,597,693 (GRCm39) Y49* probably null Het
Eefsec C T 6: 88,423,265 (GRCm39) G66D probably benign Het
Epha6 T A 16: 60,346,825 (GRCm39) Y146F probably benign Het
Fcgbpl1 C T 7: 27,836,638 (GRCm39) R186C probably damaging Het
Frmd4a A G 2: 4,591,267 (GRCm39) R96G probably damaging Het
Gm5814 A G 17: 47,721,352 (GRCm39) probably benign Het
Hspa13 C G 16: 75,554,872 (GRCm39) V405L probably damaging Het
Iqgap2 A G 13: 95,797,565 (GRCm39) V1079A probably damaging Het
Kcnj9 C A 1: 172,153,623 (GRCm39) R167L probably damaging Het
Kdm1b T A 13: 47,227,880 (GRCm39) D620E probably benign Het
Kif23 T C 9: 61,834,436 (GRCm39) R442G possibly damaging Het
Nectin1 C A 9: 43,703,179 (GRCm39) P146T possibly damaging Het
Noc4l A G 5: 110,797,461 (GRCm39) I391T probably damaging Het
Npr1 C A 3: 90,362,452 (GRCm39) R956L possibly damaging Het
Or11g7 T A 14: 50,691,412 (GRCm39) M301K possibly damaging Het
Or11j4 T A 14: 50,631,089 (GRCm39) M292K possibly damaging Het
Pcdhgb2 T C 18: 37,825,223 (GRCm39) V738A possibly damaging Het
Ptpn20 A G 14: 33,336,461 (GRCm39) E100G probably damaging Het
Rgs10 A G 7: 127,990,797 (GRCm39) F97S probably damaging Het
Shisa6 T C 11: 66,265,982 (GRCm39) probably null Het
Shld1 A T 2: 132,592,564 (GRCm39) K204* probably null Het
Supv3l1 A G 10: 62,277,016 (GRCm39) C251R probably damaging Het
Svopl T C 6: 37,998,543 (GRCm39) S244G probably benign Het
Tes T C 6: 17,099,862 (GRCm39) Y286H probably damaging Het
Tnfrsf22 G A 7: 143,193,641 (GRCm39) probably benign Het
Vmn1r185 A G 7: 26,311,160 (GRCm39) I115T probably damaging Het
Vmn2r-ps117 A G 17: 19,058,552 (GRCm39) T703A possibly damaging Het
Zan T A 5: 137,454,566 (GRCm39) I1413L unknown Het
Zc3h12d G T 10: 7,743,425 (GRCm39) M398I probably benign Het
Zfp219 G A 14: 52,244,118 (GRCm39) T642M probably benign Het
Zfp646 G A 7: 127,479,892 (GRCm39) E690K possibly damaging Het
Zfr T A 15: 12,136,541 (GRCm39) V66D unknown Het
Other mutations in Sirpb1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Sirpb1a APN 3 15,475,788 (GRCm39) unclassified probably benign
IGL00597:Sirpb1a APN 3 15,481,977 (GRCm39) missense probably damaging 1.00
IGL01521:Sirpb1a APN 3 15,475,561 (GRCm39) missense probably benign 0.00
IGL01678:Sirpb1a APN 3 15,476,370 (GRCm39) missense probably damaging 1.00
IGL02154:Sirpb1a APN 3 15,475,504 (GRCm39) missense probably damaging 1.00
IGL02275:Sirpb1a APN 3 15,475,469 (GRCm39) critical splice donor site probably null
IGL02419:Sirpb1a APN 3 15,491,398 (GRCm39) missense probably benign
IGL02657:Sirpb1a APN 3 15,482,111 (GRCm39) missense possibly damaging 0.85
IGL03086:Sirpb1a APN 3 15,491,388 (GRCm39) splice site probably null
PIT4142001:Sirpb1a UTSW 3 15,476,258 (GRCm39) missense probably benign 0.00
R0270:Sirpb1a UTSW 3 15,475,587 (GRCm39) missense probably damaging 1.00
R1975:Sirpb1a UTSW 3 15,444,141 (GRCm39) missense probably benign 0.00
R3432:Sirpb1a UTSW 3 15,491,447 (GRCm39) missense probably damaging 0.98
R4613:Sirpb1a UTSW 3 15,482,097 (GRCm39) missense probably benign 0.09
R5325:Sirpb1a UTSW 3 15,476,503 (GRCm39) missense possibly damaging 0.90
R6223:Sirpb1a UTSW 3 15,444,086 (GRCm39) missense probably benign 0.02
R6526:Sirpb1a UTSW 3 15,444,080 (GRCm39) missense probably damaging 0.99
R7349:Sirpb1a UTSW 3 15,475,664 (GRCm39) missense probably damaging 0.99
R7513:Sirpb1a UTSW 3 15,476,503 (GRCm39) missense possibly damaging 0.90
R8250:Sirpb1a UTSW 3 15,444,104 (GRCm39) missense possibly damaging 0.92
R8700:Sirpb1a UTSW 3 15,476,419 (GRCm39) missense probably damaging 0.97
R9263:Sirpb1a UTSW 3 15,481,992 (GRCm39) missense probably damaging 1.00
R9553:Sirpb1a UTSW 3 15,476,320 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCAGGTTCTTTGGTCCAGAG -3'
(R):5'- TCTAAACTGCACAGTGACATCC -3'

Sequencing Primer
(F):5'- GGTCCAGAGTTATGATAAAGTAAACC -3'
(R):5'- GCACAGTGACATCCCTCCTC -3'
Posted On 2018-11-06