Incidental Mutation 'R6903:Cct7'
ID538635
Institutional Source Beutler Lab
Gene Symbol Cct7
Ensembl Gene ENSMUSG00000030007
Gene Namechaperonin containing Tcp1, subunit 7 (eta)
SynonymsCctz, Ccth
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.940) question?
Stock #R6903 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location85451514-85468475 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85466693 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 306 (F306L)
Ref Sequence ENSEMBL: ENSMUSP00000144893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032078] [ENSMUST00000159062] [ENSMUST00000161078] [ENSMUST00000161546] [ENSMUST00000204489] [ENSMUST00000204592]
Predicted Effect probably benign
Transcript: ENSMUST00000032078
AA Change: F348L

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000032078
Gene: ENSMUSG00000030007
AA Change: F348L

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 32 524 1.8e-163 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159062
SMART Domains Protein: ENSMUSP00000125671
Gene: ENSMUSG00000047013

DomainStartEndE-ValueType
ZnF_C2H2 8 33 5.81e-2 SMART
low complexity region 65 77 N/A INTRINSIC
low complexity region 100 122 N/A INTRINSIC
low complexity region 162 192 N/A INTRINSIC
SCOP:d1eq1a_ 197 340 2e-5 SMART
low complexity region 352 374 N/A INTRINSIC
low complexity region 425 440 N/A INTRINSIC
Pfam:F-box 536 592 4.8e-5 PFAM
Pfam:F-box-like 554 593 9e-10 PFAM
low complexity region 745 759 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161078
SMART Domains Protein: ENSMUSP00000124524
Gene: ENSMUSG00000047013

DomainStartEndE-ValueType
ZnF_C2H2 8 33 5.81e-2 SMART
low complexity region 65 77 N/A INTRINSIC
low complexity region 100 122 N/A INTRINSIC
low complexity region 162 192 N/A INTRINSIC
SCOP:d1eq1a_ 197 340 2e-5 SMART
low complexity region 352 374 N/A INTRINSIC
low complexity region 425 440 N/A INTRINSIC
Pfam:F-box 536 592 4.8e-5 PFAM
Pfam:F-box-like 554 593 9e-10 PFAM
low complexity region 745 759 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161546
SMART Domains Protein: ENSMUSP00000124754
Gene: ENSMUSG00000047013

DomainStartEndE-ValueType
ZnF_C2H2 8 33 5.81e-2 SMART
low complexity region 65 77 N/A INTRINSIC
low complexity region 100 122 N/A INTRINSIC
low complexity region 162 192 N/A INTRINSIC
SCOP:d1eq1a_ 197 340 2e-5 SMART
low complexity region 352 374 N/A INTRINSIC
low complexity region 425 440 N/A INTRINSIC
low complexity region 519 540 N/A INTRINSIC
Pfam:F-box-like 554 593 5.6e-10 PFAM
low complexity region 745 759 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204489
SMART Domains Protein: ENSMUSP00000144919
Gene: ENSMUSG00000030007

DomainStartEndE-ValueType
PDB:4B2T|H 1 53 2e-29 PDB
Blast:VWA 5 51 4e-7 BLAST
SCOP:d1a6da1 16 51 2e-8 SMART
low complexity region 68 80 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204592
AA Change: F306L

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000144893
Gene: ENSMUSG00000030007
AA Change: F306L

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 32 91 6e-21 PFAM
Pfam:Cpn60_TCP1 88 482 5e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204612
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.3%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 5 and 6. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110034G24Rik A T 2: 132,750,644 K204* probably null Het
9530053A07Rik C T 7: 28,137,213 R186C probably damaging Het
Abca1 A T 4: 53,143,952 L15Q probably benign Het
Acsf2 T C 11: 94,559,591 M497V probably benign Het
Adnp2 T C 18: 80,130,090 N368S probably benign Het
BC034090 T C 1: 155,221,385 T656A probably benign Het
Bsph1 A G 7: 13,458,258 Y26C probably damaging Het
Cd109 A G 9: 78,636,603 Q143R probably damaging Het
Cfap46 A T 7: 139,654,561 probably null Het
Col3a1 A G 1: 45,331,988 N436D probably damaging Het
Col6a3 T C 1: 90,794,207 E1498G probably damaging Het
Cyp2u1 T C 3: 131,302,775 D118G probably benign Het
Dek A G 13: 47,098,187 S51P possibly damaging Het
Dock6 C T 9: 21,809,564 G1746D probably damaging Het
Dscam T A 16: 96,820,788 N488Y probably damaging Het
Ebpl G T 14: 61,360,244 Y49* probably null Het
Eefsec C T 6: 88,446,283 G66D probably benign Het
Epha6 T A 16: 60,526,462 Y146F probably benign Het
Frmd4a A G 2: 4,586,456 R96G probably damaging Het
Gm5814 A G 17: 47,410,427 probably benign Het
Hspa13 C G 16: 75,757,984 V405L probably damaging Het
Iqgap2 A G 13: 95,661,057 V1079A probably damaging Het
Kcnj9 C A 1: 172,326,056 R167L probably damaging Het
Kdm1b T A 13: 47,074,404 D620E probably benign Het
Kif23 T C 9: 61,927,154 R442G possibly damaging Het
Nectin1 C A 9: 43,791,882 P146T possibly damaging Het
Noc4l A G 5: 110,649,595 I391T probably damaging Het
Npr1 C A 3: 90,455,145 R956L possibly damaging Het
Olfr736 T A 14: 50,393,632 M292K possibly damaging Het
Olfr740 T A 14: 50,453,955 M301K possibly damaging Het
Pcdhgb2 T C 18: 37,692,170 V738A possibly damaging Het
Ptpn20 A G 14: 33,614,504 E100G probably damaging Het
Rgs10 A G 7: 128,389,073 F97S probably damaging Het
Shisa6 T C 11: 66,375,156 probably null Het
Sirpb1a T C 3: 15,416,924 T115A probably damaging Het
Supv3l1 A G 10: 62,441,237 C251R probably damaging Het
Svopl T C 6: 38,021,608 S244G probably benign Het
Tes T C 6: 17,099,863 Y286H probably damaging Het
Tnfrsf22 G A 7: 143,639,904 probably benign Het
Vmn1r185 A G 7: 26,611,735 I115T probably damaging Het
Vmn2r-ps117 A G 17: 18,838,290 T703A possibly damaging Het
Zan T A 5: 137,456,304 I1413L unknown Het
Zc3h12d G T 10: 7,867,661 M398I probably benign Het
Zfp219 G A 14: 52,006,661 T642M probably benign Het
Zfp646 G A 7: 127,880,720 E690K possibly damaging Het
Zfr T A 15: 12,136,455 V66D unknown Het
Other mutations in Cct7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02223:Cct7 APN 6 85462041 missense probably benign 0.00
IGL02292:Cct7 APN 6 85461109 missense probably benign 0.03
IGL02724:Cct7 APN 6 85459149 missense probably damaging 1.00
IGL02740:Cct7 APN 6 85468270 missense probably benign
PIT4495001:Cct7 UTSW 6 85459961 missense probably damaging 1.00
R0184:Cct7 UTSW 6 85461554 missense probably null 0.55
R1363:Cct7 UTSW 6 85466035 missense probably damaging 1.00
R1378:Cct7 UTSW 6 85467563 intron probably null
R2076:Cct7 UTSW 6 85468140 missense probably damaging 0.98
R2210:Cct7 UTSW 6 85459230 missense probably damaging 1.00
R3905:Cct7 UTSW 6 85466708 missense possibly damaging 0.90
R4298:Cct7 UTSW 6 85468173 missense probably damaging 1.00
R4422:Cct7 UTSW 6 85467145 missense probably damaging 0.98
R6519:Cct7 UTSW 6 85462150 missense probably benign 0.19
R6925:Cct7 UTSW 6 85459182 missense probably damaging 1.00
R7133:Cct7 UTSW 6 85466645 missense probably benign 0.02
R7458:Cct7 UTSW 6 85459996 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- AAAGGTGGGCTATCCTATGCAG -3'
(R):5'- GCTGTGGTATCACTGAAGCATC -3'

Sequencing Primer
(F):5'- TATCCTATGCAGAGGGCTCAG -3'
(R):5'- CTGTGGTATCACTGAAGCATCAAAGC -3'
Posted On2018-11-06