Incidental Mutation 'R6903:Tnfrsf22'
ID 538643
Institutional Source Beutler Lab
Gene Symbol Tnfrsf22
Ensembl Gene ENSMUSG00000010751
Gene Name tumor necrosis factor receptor superfamily, member 22
Synonyms Tnfrh2, mDcTrailr2, 2810028K06Rik, SOBa, C130035G06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R6903 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 143634806-143649661 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) G to A at 143639904 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075588] [ENSMUST00000084396] [ENSMUST00000146692] [ENSMUST00000171066]
AlphaFold Q9ER62
Predicted Effect unknown
Transcript: ENSMUST00000075588
AA Change: S170L
SMART Domains Protein: ENSMUSP00000075018
Gene: ENSMUSG00000010751
AA Change: S170L

DomainStartEndE-ValueType
transmembrane domain 15 34 N/A INTRINSIC
TNFR 48 82 9.53e-2 SMART
TNFR 85 124 3.31e-10 SMART
TNFR 126 165 6.48e-4 SMART
transmembrane domain 177 196 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000084396
AA Change: S170L
SMART Domains Protein: ENSMUSP00000081432
Gene: ENSMUSG00000010751
AA Change: S170L

DomainStartEndE-ValueType
transmembrane domain 15 34 N/A INTRINSIC
TNFR 48 82 9.53e-2 SMART
TNFR 85 124 3.31e-10 SMART
TNFR 126 165 6.48e-4 SMART
low complexity region 166 177 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000146692
AA Change: S170L
SMART Domains Protein: ENSMUSP00000119297
Gene: ENSMUSG00000010751
AA Change: S170L

DomainStartEndE-ValueType
transmembrane domain 15 34 N/A INTRINSIC
TNFR 48 82 9.53e-2 SMART
TNFR 85 124 3.31e-10 SMART
TNFR 126 165 6.48e-4 SMART
low complexity region 166 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171066
SMART Domains Protein: ENSMUSP00000126384
Gene: ENSMUSG00000010751

DomainStartEndE-ValueType
Pfam:RNase_H 1 93 4e-6 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.3%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110034G24Rik A T 2: 132,750,644 K204* probably null Het
9530053A07Rik C T 7: 28,137,213 R186C probably damaging Het
Abca1 A T 4: 53,143,952 L15Q probably benign Het
Acsf2 T C 11: 94,559,591 M497V probably benign Het
Adnp2 T C 18: 80,130,090 N368S probably benign Het
BC034090 T C 1: 155,221,385 T656A probably benign Het
Bsph1 A G 7: 13,458,258 Y26C probably damaging Het
Cct7 T C 6: 85,466,693 F306L probably benign Het
Cd109 A G 9: 78,636,603 Q143R probably damaging Het
Cfap46 A T 7: 139,654,561 probably null Het
Col3a1 A G 1: 45,331,988 N436D probably damaging Het
Col6a3 T C 1: 90,794,207 E1498G probably damaging Het
Cyp2u1 T C 3: 131,302,775 D118G probably benign Het
Dek A G 13: 47,098,187 S51P possibly damaging Het
Dock6 C T 9: 21,809,564 G1746D probably damaging Het
Dscam T A 16: 96,820,788 N488Y probably damaging Het
Ebpl G T 14: 61,360,244 Y49* probably null Het
Eefsec C T 6: 88,446,283 G66D probably benign Het
Epha6 T A 16: 60,526,462 Y146F probably benign Het
Frmd4a A G 2: 4,586,456 R96G probably damaging Het
Gm5814 A G 17: 47,410,427 probably benign Het
Hspa13 C G 16: 75,757,984 V405L probably damaging Het
Iqgap2 A G 13: 95,661,057 V1079A probably damaging Het
Kcnj9 C A 1: 172,326,056 R167L probably damaging Het
Kdm1b T A 13: 47,074,404 D620E probably benign Het
Kif23 T C 9: 61,927,154 R442G possibly damaging Het
Nectin1 C A 9: 43,791,882 P146T possibly damaging Het
Noc4l A G 5: 110,649,595 I391T probably damaging Het
Npr1 C A 3: 90,455,145 R956L possibly damaging Het
Olfr736 T A 14: 50,393,632 M292K possibly damaging Het
Olfr740 T A 14: 50,453,955 M301K possibly damaging Het
Pcdhgb2 T C 18: 37,692,170 V738A possibly damaging Het
Ptpn20 A G 14: 33,614,504 E100G probably damaging Het
Rgs10 A G 7: 128,389,073 F97S probably damaging Het
Shisa6 T C 11: 66,375,156 probably null Het
Sirpb1a T C 3: 15,416,924 T115A probably damaging Het
Supv3l1 A G 10: 62,441,237 C251R probably damaging Het
Svopl T C 6: 38,021,608 S244G probably benign Het
Tes T C 6: 17,099,863 Y286H probably damaging Het
Vmn1r185 A G 7: 26,611,735 I115T probably damaging Het
Vmn2r-ps117 A G 17: 18,838,290 T703A possibly damaging Het
Zan T A 5: 137,456,304 I1413L unknown Het
Zc3h12d G T 10: 7,867,661 M398I probably benign Het
Zfp219 G A 14: 52,006,661 T642M probably benign Het
Zfp646 G A 7: 127,880,720 E690K possibly damaging Het
Zfr T A 15: 12,136,455 V66D unknown Het
Other mutations in Tnfrsf22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Tnfrsf22 APN 7 143643374 missense probably damaging 1.00
IGL01959:Tnfrsf22 APN 7 143643275 critical splice donor site probably null
IGL02395:Tnfrsf22 APN 7 143643316 missense probably damaging 1.00
IGL02608:Tnfrsf22 APN 7 143644796 nonsense probably null
IGL03054:Tnfrsf22 UTSW 7 143640795 missense probably damaging 1.00
R1987:Tnfrsf22 UTSW 7 143638389 unclassified probably benign
R2228:Tnfrsf22 UTSW 7 143644776 splice site probably null
R2229:Tnfrsf22 UTSW 7 143644776 splice site probably null
R4562:Tnfrsf22 UTSW 7 143649576 missense unknown
R4829:Tnfrsf22 UTSW 7 143643330 missense possibly damaging 0.91
R6486:Tnfrsf22 UTSW 7 143640756 missense possibly damaging 0.93
R7146:Tnfrsf22 UTSW 7 143640819 missense probably damaging 1.00
R7406:Tnfrsf22 UTSW 7 143640827 missense probably damaging 1.00
R8108:Tnfrsf22 UTSW 7 143638373 missense unknown
R8969:Tnfrsf22 UTSW 7 143638436 missense unknown
R9613:Tnfrsf22 UTSW 7 143644846 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAGGAGCTGGTATTCAGTTTC -3'
(R):5'- TCTTGGATCAGGATGCTGCC -3'

Sequencing Primer
(F):5'- ATAGCACTGGCCACCTATGTG -3'
(R):5'- AGGATGCTGCCTGATGTG -3'
Posted On 2018-11-06