Incidental Mutation 'R6903:Nectin1'
ID538645
Institutional Source Beutler Lab
Gene Symbol Nectin1
Ensembl Gene ENSMUSG00000032012
Gene Namenectin cell adhesion molecule 1
SynonymsHveC, Pvrl1, HIgR, nectin-1, PRR, Cd111, PRR1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.708) question?
Stock #R6903 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location43743984-43807461 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 43791882 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 146 (P146T)
Ref Sequence ENSEMBL: ENSMUSP00000034510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034510] [ENSMUST00000216893]
PDB Structure
Solution structure of the third Immunoglobulin-like domain of nectin-1 [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034510
AA Change: P146T

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034510
Gene: ENSMUSG00000032012
AA Change: P146T

DomainStartEndE-ValueType
low complexity region 1 20 N/A INTRINSIC
IG 36 143 8.51e-7 SMART
Pfam:C2-set_2 148 237 8.5e-21 PFAM
IG 254 334 1.28e-1 SMART
transmembrane domain 355 377 N/A INTRINSIC
low complexity region 436 448 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000216893
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.3%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adhesion protein that plays a role in the organization of adherens junctions and tight junctions in epithelial and endothelial cells. The protein is a calcium(2+)-independent cell-cell adhesion molecule that belongs to the immunoglobulin superfamily and has 3 extracellular immunoglobulin-like loops, a single transmembrane domain (in some isoforms), and a cytoplasmic region. This protein acts as a receptor for glycoprotein D (gD) of herpes simplex viruses 1 and 2 (HSV-1, HSV-2), and pseudorabies virus (PRV) and mediates viral entry into epithelial and neuronal cells. Mutations in this gene cause cleft lip and palate/ectodermal dysplasia 1 syndrome (CLPED1) as well as non-syndromic cleft lip with or without cleft palate (CL/P). Alternative splicing results in multiple transcript variants encoding proteins with distinct C-termini. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice exhibit eye abnormalities including microphthalmia, absent vitreous body, abnormal ciliary body, retinal layers, and lenses, and open eyelids at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110034G24Rik A T 2: 132,750,644 K204* probably null Het
9530053A07Rik C T 7: 28,137,213 R186C probably damaging Het
Abca1 A T 4: 53,143,952 L15Q probably benign Het
Acsf2 T C 11: 94,559,591 M497V probably benign Het
Adnp2 T C 18: 80,130,090 N368S probably benign Het
BC034090 T C 1: 155,221,385 T656A probably benign Het
Bsph1 A G 7: 13,458,258 Y26C probably damaging Het
Cct7 T C 6: 85,466,693 F306L probably benign Het
Cd109 A G 9: 78,636,603 Q143R probably damaging Het
Cfap46 A T 7: 139,654,561 probably null Het
Col3a1 A G 1: 45,331,988 N436D probably damaging Het
Col6a3 T C 1: 90,794,207 E1498G probably damaging Het
Cyp2u1 T C 3: 131,302,775 D118G probably benign Het
Dek A G 13: 47,098,187 S51P possibly damaging Het
Dock6 C T 9: 21,809,564 G1746D probably damaging Het
Dscam T A 16: 96,820,788 N488Y probably damaging Het
Ebpl G T 14: 61,360,244 Y49* probably null Het
Eefsec C T 6: 88,446,283 G66D probably benign Het
Epha6 T A 16: 60,526,462 Y146F probably benign Het
Frmd4a A G 2: 4,586,456 R96G probably damaging Het
Gm5814 A G 17: 47,410,427 probably benign Het
Hspa13 C G 16: 75,757,984 V405L probably damaging Het
Iqgap2 A G 13: 95,661,057 V1079A probably damaging Het
Kcnj9 C A 1: 172,326,056 R167L probably damaging Het
Kdm1b T A 13: 47,074,404 D620E probably benign Het
Kif23 T C 9: 61,927,154 R442G possibly damaging Het
Noc4l A G 5: 110,649,595 I391T probably damaging Het
Npr1 C A 3: 90,455,145 R956L possibly damaging Het
Olfr736 T A 14: 50,393,632 M292K possibly damaging Het
Olfr740 T A 14: 50,453,955 M301K possibly damaging Het
Pcdhgb2 T C 18: 37,692,170 V738A possibly damaging Het
Ptpn20 A G 14: 33,614,504 E100G probably damaging Het
Rgs10 A G 7: 128,389,073 F97S probably damaging Het
Shisa6 T C 11: 66,375,156 probably null Het
Sirpb1a T C 3: 15,416,924 T115A probably damaging Het
Supv3l1 A G 10: 62,441,237 C251R probably damaging Het
Svopl T C 6: 38,021,608 S244G probably benign Het
Tes T C 6: 17,099,863 Y286H probably damaging Het
Tnfrsf22 G A 7: 143,639,904 probably benign Het
Vmn1r185 A G 7: 26,611,735 I115T probably damaging Het
Vmn2r-ps117 A G 17: 18,838,290 T703A possibly damaging Het
Zan T A 5: 137,456,304 I1413L unknown Het
Zc3h12d G T 10: 7,867,661 M398I probably benign Het
Zfp219 G A 14: 52,006,661 T642M probably benign Het
Zfp646 G A 7: 127,880,720 E690K possibly damaging Het
Zfr T A 15: 12,136,455 V66D unknown Het
Other mutations in Nectin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01618:Nectin1 APN 9 43791258 nonsense probably null
IGL01939:Nectin1 APN 9 43792574 unclassified probably benign
IGL01978:Nectin1 APN 9 43792147 missense probably damaging 0.99
IGL02795:Nectin1 APN 9 43803552 missense probably benign
K3955:Nectin1 UTSW 9 43792078 missense probably damaging 1.00
R0563:Nectin1 UTSW 9 43791045 missense probably benign
R1439:Nectin1 UTSW 9 43792099 missense possibly damaging 0.78
R1822:Nectin1 UTSW 9 43791077 nonsense probably null
R4356:Nectin1 UTSW 9 43792505 missense probably benign 0.22
R5153:Nectin1 UTSW 9 43803498 missense probably damaging 0.99
R5516:Nectin1 UTSW 9 43803793 missense probably benign 0.03
R5864:Nectin1 UTSW 9 43791310 missense probably damaging 1.00
R7791:Nectin1 UTSW 9 43792039 missense probably benign 0.08
R7878:Nectin1 UTSW 9 43803901 missense probably benign 0.10
R7961:Nectin1 UTSW 9 43803901 missense probably benign 0.10
R8046:Nectin1 UTSW 9 43792501 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCAGGTGCTTTAGACACTGTG -3'
(R):5'- CCATTGGGGTTCCGAATTTCC -3'

Sequencing Primer
(F):5'- GAAGCCTAAAACCAGGTCTGTTTGC -3'
(R):5'- GGGTTCCGAATTTCCTGGTACTC -3'
Posted On2018-11-06