Incidental Mutation 'R6903:Zc3h12d'
ID538648
Institutional Source Beutler Lab
Gene Symbol Zc3h12d
Ensembl Gene ENSMUSG00000039981
Gene Namezinc finger CCCH type containing 12D
SynonymsD730019B10Rik, TFL
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R6903 (G1)
Quality Score196.009
Status Validated
Chromosome10
Chromosomal Location7832470-7870396 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 7867661 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 398 (M398I)
Ref Sequence ENSEMBL: ENSMUSP00000040217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039484]
Predicted Effect probably benign
Transcript: ENSMUST00000039484
AA Change: M398I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000040217
Gene: ENSMUSG00000039981
AA Change: M398I

DomainStartEndE-ValueType
Pfam:RNase_Zc3h12a 91 247 4e-67 PFAM
low complexity region 333 345 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.3%
Validation Efficiency 100% (46/46)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit disrupted regulation of excessive inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110034G24Rik A T 2: 132,750,644 K204* probably null Het
9530053A07Rik C T 7: 28,137,213 R186C probably damaging Het
Abca1 A T 4: 53,143,952 L15Q probably benign Het
Acsf2 T C 11: 94,559,591 M497V probably benign Het
Adnp2 T C 18: 80,130,090 N368S probably benign Het
BC034090 T C 1: 155,221,385 T656A probably benign Het
Bsph1 A G 7: 13,458,258 Y26C probably damaging Het
Cct7 T C 6: 85,466,693 F306L probably benign Het
Cd109 A G 9: 78,636,603 Q143R probably damaging Het
Cfap46 A T 7: 139,654,561 probably null Het
Col3a1 A G 1: 45,331,988 N436D probably damaging Het
Col6a3 T C 1: 90,794,207 E1498G probably damaging Het
Cyp2u1 T C 3: 131,302,775 D118G probably benign Het
Dek A G 13: 47,098,187 S51P possibly damaging Het
Dock6 C T 9: 21,809,564 G1746D probably damaging Het
Dscam T A 16: 96,820,788 N488Y probably damaging Het
Ebpl G T 14: 61,360,244 Y49* probably null Het
Eefsec C T 6: 88,446,283 G66D probably benign Het
Epha6 T A 16: 60,526,462 Y146F probably benign Het
Frmd4a A G 2: 4,586,456 R96G probably damaging Het
Gm5814 A G 17: 47,410,427 probably benign Het
Hspa13 C G 16: 75,757,984 V405L probably damaging Het
Iqgap2 A G 13: 95,661,057 V1079A probably damaging Het
Kcnj9 C A 1: 172,326,056 R167L probably damaging Het
Kdm1b T A 13: 47,074,404 D620E probably benign Het
Kif23 T C 9: 61,927,154 R442G possibly damaging Het
Nectin1 C A 9: 43,791,882 P146T possibly damaging Het
Noc4l A G 5: 110,649,595 I391T probably damaging Het
Npr1 C A 3: 90,455,145 R956L possibly damaging Het
Olfr736 T A 14: 50,393,632 M292K possibly damaging Het
Olfr740 T A 14: 50,453,955 M301K possibly damaging Het
Pcdhgb2 T C 18: 37,692,170 V738A possibly damaging Het
Ptpn20 A G 14: 33,614,504 E100G probably damaging Het
Rgs10 A G 7: 128,389,073 F97S probably damaging Het
Shisa6 T C 11: 66,375,156 probably null Het
Sirpb1a T C 3: 15,416,924 T115A probably damaging Het
Supv3l1 A G 10: 62,441,237 C251R probably damaging Het
Svopl T C 6: 38,021,608 S244G probably benign Het
Tes T C 6: 17,099,863 Y286H probably damaging Het
Tnfrsf22 G A 7: 143,639,904 probably benign Het
Vmn1r185 A G 7: 26,611,735 I115T probably damaging Het
Vmn2r-ps117 A G 17: 18,838,290 T703A possibly damaging Het
Zan T A 5: 137,456,304 I1413L unknown Het
Zfp219 G A 14: 52,006,661 T642M probably benign Het
Zfp646 G A 7: 127,880,720 E690K possibly damaging Het
Zfr T A 15: 12,136,455 V66D unknown Het
Other mutations in Zc3h12d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Zc3h12d APN 10 7862467 missense probably damaging 1.00
IGL01013:Zc3h12d APN 10 7839956 missense probably damaging 1.00
IGL02090:Zc3h12d APN 10 7867332 missense probably benign 0.00
IGL02876:Zc3h12d APN 10 7862600 missense probably damaging 0.99
R0040:Zc3h12d UTSW 10 7867914 missense probably benign 0.02
R0040:Zc3h12d UTSW 10 7867914 missense probably benign 0.02
R0242:Zc3h12d UTSW 10 7862566 missense probably damaging 1.00
R0242:Zc3h12d UTSW 10 7862566 missense probably damaging 1.00
R1942:Zc3h12d UTSW 10 7853313 missense probably damaging 1.00
R2290:Zc3h12d UTSW 10 7867459 missense probably benign 0.00
R2354:Zc3h12d UTSW 10 7867938 missense probably benign 0.00
R4816:Zc3h12d UTSW 10 7867947 missense probably damaging 1.00
R4932:Zc3h12d UTSW 10 7853250 missense probably damaging 0.99
R5191:Zc3h12d UTSW 10 7867818 missense possibly damaging 0.51
R5384:Zc3h12d UTSW 10 7853250 missense probably damaging 1.00
R5396:Zc3h12d UTSW 10 7866326 missense probably damaging 1.00
R6409:Zc3h12d UTSW 10 7867318 missense probably benign 0.04
R6877:Zc3h12d UTSW 10 7839971 missense probably damaging 0.99
R6967:Zc3h12d UTSW 10 7839880 missense probably damaging 1.00
R7312:Zc3h12d UTSW 10 7867581 missense probably benign 0.00
R7594:Zc3h12d UTSW 10 7862618 missense probably damaging 1.00
R7622:Zc3h12d UTSW 10 7867269 missense probably damaging 1.00
R7645:Zc3h12d UTSW 10 7867576 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTGGCAGCTTTGAATAGGAGC -3'
(R):5'- GGTCCTCTAAAGATGTCCTCACC -3'

Sequencing Primer
(F):5'- CAGCTTTGAATAGGAGCTTCGC -3'
(R):5'- CCGAGTGGTTCAGATAACAATAGG -3'
Posted On2018-11-06