Incidental Mutation 'R6903:Acsf2'
ID 538650
Institutional Source Beutler Lab
Gene Symbol Acsf2
Ensembl Gene ENSMUSG00000076435
Gene Name acyl-CoA synthetase family member 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6903 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 94557102-94601871 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 94559591 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 497 (M497V)
Ref Sequence ENSEMBL: ENSMUSP00000099453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103164]
AlphaFold Q8VCW8
Predicted Effect probably benign
Transcript: ENSMUST00000103164
AA Change: M497V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000099453
Gene: ENSMUSG00000076435
AA Change: M497V

DomainStartEndE-ValueType
Pfam:AMP-binding 78 516 3.9e-100 PFAM
Pfam:AMP-binding_C 524 599 1.7e-20 PFAM
Meta Mutation Damage Score 0.4778 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.3%
Validation Efficiency 100% (46/46)
MGI Phenotype PHENOTYPE: Phenotypic analysis of mice homozygous for a gene trap allele indicates this mutation has no notable phenotype in any parameter tested. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110034G24Rik A T 2: 132,750,644 K204* probably null Het
9530053A07Rik C T 7: 28,137,213 R186C probably damaging Het
Abca1 A T 4: 53,143,952 L15Q probably benign Het
Adnp2 T C 18: 80,130,090 N368S probably benign Het
BC034090 T C 1: 155,221,385 T656A probably benign Het
Bsph1 A G 7: 13,458,258 Y26C probably damaging Het
Cct7 T C 6: 85,466,693 F306L probably benign Het
Cd109 A G 9: 78,636,603 Q143R probably damaging Het
Cfap46 A T 7: 139,654,561 probably null Het
Col3a1 A G 1: 45,331,988 N436D probably damaging Het
Col6a3 T C 1: 90,794,207 E1498G probably damaging Het
Cyp2u1 T C 3: 131,302,775 D118G probably benign Het
Dek A G 13: 47,098,187 S51P possibly damaging Het
Dock6 C T 9: 21,809,564 G1746D probably damaging Het
Dscam T A 16: 96,820,788 N488Y probably damaging Het
Ebpl G T 14: 61,360,244 Y49* probably null Het
Eefsec C T 6: 88,446,283 G66D probably benign Het
Epha6 T A 16: 60,526,462 Y146F probably benign Het
Frmd4a A G 2: 4,586,456 R96G probably damaging Het
Gm5814 A G 17: 47,410,427 probably benign Het
Hspa13 C G 16: 75,757,984 V405L probably damaging Het
Iqgap2 A G 13: 95,661,057 V1079A probably damaging Het
Kcnj9 C A 1: 172,326,056 R167L probably damaging Het
Kdm1b T A 13: 47,074,404 D620E probably benign Het
Kif23 T C 9: 61,927,154 R442G possibly damaging Het
Nectin1 C A 9: 43,791,882 P146T possibly damaging Het
Noc4l A G 5: 110,649,595 I391T probably damaging Het
Npr1 C A 3: 90,455,145 R956L possibly damaging Het
Olfr736 T A 14: 50,393,632 M292K possibly damaging Het
Olfr740 T A 14: 50,453,955 M301K possibly damaging Het
Pcdhgb2 T C 18: 37,692,170 V738A possibly damaging Het
Ptpn20 A G 14: 33,614,504 E100G probably damaging Het
Rgs10 A G 7: 128,389,073 F97S probably damaging Het
Shisa6 T C 11: 66,375,156 probably null Het
Sirpb1a T C 3: 15,416,924 T115A probably damaging Het
Supv3l1 A G 10: 62,441,237 C251R probably damaging Het
Svopl T C 6: 38,021,608 S244G probably benign Het
Tes T C 6: 17,099,863 Y286H probably damaging Het
Tnfrsf22 G A 7: 143,639,904 probably benign Het
Vmn1r185 A G 7: 26,611,735 I115T probably damaging Het
Vmn2r-ps117 A G 17: 18,838,290 T703A possibly damaging Het
Zan T A 5: 137,456,304 I1413L unknown Het
Zc3h12d G T 10: 7,867,661 M398I probably benign Het
Zfp219 G A 14: 52,006,661 T642M probably benign Het
Zfp646 G A 7: 127,880,720 E690K possibly damaging Het
Zfr T A 15: 12,136,455 V66D unknown Het
Other mutations in Acsf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Acsf2 APN 11 94570450 missense probably benign 0.00
IGL02218:Acsf2 APN 11 94601763 missense probably benign 0.00
IGL02602:Acsf2 APN 11 94570465 splice site probably benign
Citrus UTSW 11 94571650 missense probably benign 0.11
Cocktail UTSW 11 94570385 missense probably benign 0.06
limonene UTSW 11 94562888 missense probably damaging 0.99
R0047:Acsf2 UTSW 11 94569342 missense probably benign 0.01
R0194:Acsf2 UTSW 11 94561370 missense probably benign 0.00
R1400:Acsf2 UTSW 11 94570316 missense probably benign 0.07
R1403:Acsf2 UTSW 11 94562874 missense probably benign 0.11
R1403:Acsf2 UTSW 11 94562874 missense probably benign 0.11
R1512:Acsf2 UTSW 11 94561398 splice site probably benign
R2007:Acsf2 UTSW 11 94571640 missense possibly damaging 0.88
R2271:Acsf2 UTSW 11 94558873 nonsense probably null
R3610:Acsf2 UTSW 11 94561346 missense probably benign 0.00
R4447:Acsf2 UTSW 11 94569359 missense possibly damaging 0.68
R4717:Acsf2 UTSW 11 94559546 missense probably benign 0.02
R4857:Acsf2 UTSW 11 94569338 missense probably benign 0.07
R4974:Acsf2 UTSW 11 94569329 missense possibly damaging 0.77
R5090:Acsf2 UTSW 11 94571269 critical splice donor site probably null
R5185:Acsf2 UTSW 11 94562911 missense probably damaging 1.00
R5732:Acsf2 UTSW 11 94569942 unclassified probably benign
R5797:Acsf2 UTSW 11 94571679 missense probably damaging 0.98
R5872:Acsf2 UTSW 11 94573149 missense probably benign 0.16
R6350:Acsf2 UTSW 11 94558330 missense probably benign 0.12
R6912:Acsf2 UTSW 11 94570380 missense probably benign
R7336:Acsf2 UTSW 11 94571650 missense probably benign 0.11
R7531:Acsf2 UTSW 11 94573231 splice site probably null
R8026:Acsf2 UTSW 11 94562888 missense probably damaging 0.99
R8231:Acsf2 UTSW 11 94561362 missense probably benign 0.01
R8355:Acsf2 UTSW 11 94570624 missense probably benign 0.00
R8486:Acsf2 UTSW 11 94569960 missense probably damaging 0.98
R8525:Acsf2 UTSW 11 94572620 missense probably benign 0.21
R8956:Acsf2 UTSW 11 94570385 missense probably benign 0.06
R9288:Acsf2 UTSW 11 94573218 missense probably benign 0.04
R9481:Acsf2 UTSW 11 94573218 missense probably benign 0.04
R9564:Acsf2 UTSW 11 94573065 missense possibly damaging 0.88
R9620:Acsf2 UTSW 11 94572586 nonsense probably null
R9671:Acsf2 UTSW 11 94569976 missense probably benign 0.27
R9742:Acsf2 UTSW 11 94573137 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TAAGACGAACCCCTTCATCAGG -3'
(R):5'- ACGTGATGGGTGCTATACTG -3'

Sequencing Primer
(F):5'- TTCATCAGGCAACCCCGGAG -3'
(R):5'- ATAATTTTCCAGCCTGGCCTGTAGG -3'
Posted On 2018-11-06