Incidental Mutation 'R6903:Olfr736'
ID538655
Institutional Source Beutler Lab
Gene Symbol Olfr736
Ensembl Gene ENSMUSG00000047716
Gene Nameolfactory receptor 736
SynonymsMOR106-5, GA_x6K02T2PMLR-6089963-6090901
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R6903 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location50381163-50394192 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50393632 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 292 (M292K)
Ref Sequence ENSEMBL: ENSMUSP00000149654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058965] [ENSMUST00000213402] [ENSMUST00000213755] [ENSMUST00000215227] [ENSMUST00000215263]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058965
AA Change: M292K

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000062700
Gene: ENSMUSG00000047716
AA Change: M292K

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 1.5e-45 PFAM
Pfam:7TM_GPCR_Srsx 37 175 6.9e-7 PFAM
Pfam:7tm_1 43 294 4.7e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213402
AA Change: M292K

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000213755
AA Change: M292K

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215227
AA Change: M292K

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215263
AA Change: M292K

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.3%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110034G24Rik A T 2: 132,750,644 K204* probably null Het
9530053A07Rik C T 7: 28,137,213 R186C probably damaging Het
Abca1 A T 4: 53,143,952 L15Q probably benign Het
Acsf2 T C 11: 94,559,591 M497V probably benign Het
Adnp2 T C 18: 80,130,090 N368S probably benign Het
BC034090 T C 1: 155,221,385 T656A probably benign Het
Bsph1 A G 7: 13,458,258 Y26C probably damaging Het
Cct7 T C 6: 85,466,693 F306L probably benign Het
Cd109 A G 9: 78,636,603 Q143R probably damaging Het
Cfap46 A T 7: 139,654,561 probably null Het
Col3a1 A G 1: 45,331,988 N436D probably damaging Het
Col6a3 T C 1: 90,794,207 E1498G probably damaging Het
Cyp2u1 T C 3: 131,302,775 D118G probably benign Het
Dek A G 13: 47,098,187 S51P possibly damaging Het
Dock6 C T 9: 21,809,564 G1746D probably damaging Het
Dscam T A 16: 96,820,788 N488Y probably damaging Het
Ebpl G T 14: 61,360,244 Y49* probably null Het
Eefsec C T 6: 88,446,283 G66D probably benign Het
Epha6 T A 16: 60,526,462 Y146F probably benign Het
Frmd4a A G 2: 4,586,456 R96G probably damaging Het
Gm5814 A G 17: 47,410,427 probably benign Het
Hspa13 C G 16: 75,757,984 V405L probably damaging Het
Iqgap2 A G 13: 95,661,057 V1079A probably damaging Het
Kcnj9 C A 1: 172,326,056 R167L probably damaging Het
Kdm1b T A 13: 47,074,404 D620E probably benign Het
Kif23 T C 9: 61,927,154 R442G possibly damaging Het
Nectin1 C A 9: 43,791,882 P146T possibly damaging Het
Noc4l A G 5: 110,649,595 I391T probably damaging Het
Npr1 C A 3: 90,455,145 R956L possibly damaging Het
Olfr740 T A 14: 50,453,955 M301K possibly damaging Het
Pcdhgb2 T C 18: 37,692,170 V738A possibly damaging Het
Ptpn20 A G 14: 33,614,504 E100G probably damaging Het
Rgs10 A G 7: 128,389,073 F97S probably damaging Het
Shisa6 T C 11: 66,375,156 probably null Het
Sirpb1a T C 3: 15,416,924 T115A probably damaging Het
Supv3l1 A G 10: 62,441,237 C251R probably damaging Het
Svopl T C 6: 38,021,608 S244G probably benign Het
Tes T C 6: 17,099,863 Y286H probably damaging Het
Tnfrsf22 G A 7: 143,639,904 probably benign Het
Vmn1r185 A G 7: 26,611,735 I115T probably damaging Het
Vmn2r-ps117 A G 17: 18,838,290 T703A possibly damaging Het
Zan T A 5: 137,456,304 I1413L unknown Het
Zc3h12d G T 10: 7,867,661 M398I probably benign Het
Zfp219 G A 14: 52,006,661 T642M probably benign Het
Zfp646 G A 7: 127,880,720 E690K possibly damaging Het
Zfr T A 15: 12,136,455 V66D unknown Het
Other mutations in Olfr736
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01765:Olfr736 APN 14 50392834 missense probably benign 0.33
IGL01952:Olfr736 APN 14 50393403 missense probably benign 0.02
IGL01996:Olfr736 APN 14 50393659 missense probably damaging 0.99
IGL02694:Olfr736 APN 14 50392800 missense probably benign 0.02
IGL02717:Olfr736 APN 14 50393647 missense probably damaging 1.00
IGL03185:Olfr736 APN 14 50393398 missense probably damaging 0.99
IGL03218:Olfr736 APN 14 50393658 missense probably damaging 0.98
IGL03048:Olfr736 UTSW 14 50392788 missense possibly damaging 0.47
R0066:Olfr736 UTSW 14 50393202 missense probably benign 0.08
R0066:Olfr736 UTSW 14 50393202 missense probably benign 0.08
R0089:Olfr736 UTSW 14 50392864 missense probably benign
R0254:Olfr736 UTSW 14 50393079 missense probably damaging 0.99
R0284:Olfr736 UTSW 14 50392995 missense probably damaging 1.00
R1800:Olfr736 UTSW 14 50393329 nonsense probably null
R3885:Olfr736 UTSW 14 50392869 missense probably benign 0.05
R4302:Olfr736 UTSW 14 50393446 missense probably benign 0.23
R4452:Olfr736 UTSW 14 50392912 missense probably benign
R4705:Olfr736 UTSW 14 50392800 missense probably benign 0.02
R5340:Olfr736 UTSW 14 50393220 missense probably damaging 0.98
R6007:Olfr736 UTSW 14 50393491 missense probably damaging 1.00
R6338:Olfr736 UTSW 14 50393400 missense possibly damaging 0.47
R6358:Olfr736 UTSW 14 50393388 missense possibly damaging 0.78
R6521:Olfr736 UTSW 14 50393548 missense possibly damaging 0.95
R6527:Olfr736 UTSW 14 50393428 nonsense probably null
R6777:Olfr736 UTSW 14 50393658 missense probably damaging 0.98
X0026:Olfr736 UTSW 14 50393541 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TGCTGGTTCAAAGAAGGCATTCTC -3'
(R):5'- TGACCTATGGCTTCAGGCTTC -3'

Sequencing Primer
(F):5'- GTTCAAAGAAGGCATTCTCCACCTG -3'
(R):5'- CAGGCTTCTGACATTGCCATATAAG -3'
Posted On2018-11-06