Incidental Mutation 'R6903:Adnp2'
ID538666
Institutional Source Beutler Lab
Gene Symbol Adnp2
Ensembl Gene ENSMUSG00000053950
Gene NameADNP homeobox 2
SynonymsZfp508, 8430420L05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6903 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location80126311-80151482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80130090 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 368 (N368S)
Ref Sequence ENSEMBL: ENSMUSP00000068560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066743]
Predicted Effect probably benign
Transcript: ENSMUST00000066743
AA Change: N368S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000068560
Gene: ENSMUSG00000053950
AA Change: N368S

DomainStartEndE-ValueType
ZnF_C2H2 73 96 4.57e0 SMART
ZnF_C2H2 106 128 1.06e2 SMART
ZnF_C2H2 155 178 5.48e0 SMART
ZnF_C2H2 215 240 7.29e0 SMART
low complexity region 277 290 N/A INTRINSIC
low complexity region 298 318 N/A INTRINSIC
low complexity region 333 355 N/A INTRINSIC
low complexity region 545 567 N/A INTRINSIC
low complexity region 625 648 N/A INTRINSIC
low complexity region 656 674 N/A INTRINSIC
ZnF_C2H2 696 718 9.96e0 SMART
ZnF_C2H2 724 746 4.99e1 SMART
low complexity region 747 761 N/A INTRINSIC
ZnF_C2H2 777 798 1.93e2 SMART
ZnF_C2H2 800 823 4.34e0 SMART
ZnF_C2H2 905 928 5.81e-2 SMART
HOX 1073 1135 3.25e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.3%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110034G24Rik A T 2: 132,750,644 K204* probably null Het
9530053A07Rik C T 7: 28,137,213 R186C probably damaging Het
Abca1 A T 4: 53,143,952 L15Q probably benign Het
Acsf2 T C 11: 94,559,591 M497V probably benign Het
BC034090 T C 1: 155,221,385 T656A probably benign Het
Bsph1 A G 7: 13,458,258 Y26C probably damaging Het
Cct7 T C 6: 85,466,693 F306L probably benign Het
Cd109 A G 9: 78,636,603 Q143R probably damaging Het
Cfap46 A T 7: 139,654,561 probably null Het
Col3a1 A G 1: 45,331,988 N436D probably damaging Het
Col6a3 T C 1: 90,794,207 E1498G probably damaging Het
Cyp2u1 T C 3: 131,302,775 D118G probably benign Het
Dek A G 13: 47,098,187 S51P possibly damaging Het
Dock6 C T 9: 21,809,564 G1746D probably damaging Het
Dscam T A 16: 96,820,788 N488Y probably damaging Het
Ebpl G T 14: 61,360,244 Y49* probably null Het
Eefsec C T 6: 88,446,283 G66D probably benign Het
Epha6 T A 16: 60,526,462 Y146F probably benign Het
Frmd4a A G 2: 4,586,456 R96G probably damaging Het
Gm5814 A G 17: 47,410,427 probably benign Het
Hspa13 C G 16: 75,757,984 V405L probably damaging Het
Iqgap2 A G 13: 95,661,057 V1079A probably damaging Het
Kcnj9 C A 1: 172,326,056 R167L probably damaging Het
Kdm1b T A 13: 47,074,404 D620E probably benign Het
Kif23 T C 9: 61,927,154 R442G possibly damaging Het
Nectin1 C A 9: 43,791,882 P146T possibly damaging Het
Noc4l A G 5: 110,649,595 I391T probably damaging Het
Npr1 C A 3: 90,455,145 R956L possibly damaging Het
Olfr736 T A 14: 50,393,632 M292K possibly damaging Het
Olfr740 T A 14: 50,453,955 M301K possibly damaging Het
Pcdhgb2 T C 18: 37,692,170 V738A possibly damaging Het
Ptpn20 A G 14: 33,614,504 E100G probably damaging Het
Rgs10 A G 7: 128,389,073 F97S probably damaging Het
Shisa6 T C 11: 66,375,156 probably null Het
Sirpb1a T C 3: 15,416,924 T115A probably damaging Het
Supv3l1 A G 10: 62,441,237 C251R probably damaging Het
Svopl T C 6: 38,021,608 S244G probably benign Het
Tes T C 6: 17,099,863 Y286H probably damaging Het
Tnfrsf22 G A 7: 143,639,904 probably benign Het
Vmn1r185 A G 7: 26,611,735 I115T probably damaging Het
Vmn2r-ps117 A G 17: 18,838,290 T703A possibly damaging Het
Zan T A 5: 137,456,304 I1413L unknown Het
Zc3h12d G T 10: 7,867,661 M398I probably benign Het
Zfp219 G A 14: 52,006,661 T642M probably benign Het
Zfp646 G A 7: 127,880,720 E690K possibly damaging Het
Zfr T A 15: 12,136,455 V66D unknown Het
Other mutations in Adnp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Adnp2 APN 18 80128867 missense probably benign 0.00
IGL00730:Adnp2 APN 18 80128032 missense probably benign
IGL01615:Adnp2 APN 18 80128477 missense probably damaging 1.00
IGL01681:Adnp2 APN 18 80127888 missense probably damaging 1.00
IGL02549:Adnp2 APN 18 80129118 missense probably damaging 1.00
R0003:Adnp2 UTSW 18 80130990 missense probably damaging 1.00
R0003:Adnp2 UTSW 18 80130990 missense probably damaging 1.00
R0013:Adnp2 UTSW 18 80129745 missense probably damaging 0.99
R0013:Adnp2 UTSW 18 80129745 missense probably damaging 0.99
R0325:Adnp2 UTSW 18 80130653 missense probably benign 0.06
R0478:Adnp2 UTSW 18 80129334 missense probably benign 0.31
R0545:Adnp2 UTSW 18 80129401 missense probably benign 0.31
R0788:Adnp2 UTSW 18 80130004 missense probably benign
R1756:Adnp2 UTSW 18 80127697 makesense probably null
R2043:Adnp2 UTSW 18 80128326 missense probably damaging 1.00
R2121:Adnp2 UTSW 18 80129170 missense probably benign 0.00
R2260:Adnp2 UTSW 18 80128449 missense probably benign 0.01
R2374:Adnp2 UTSW 18 80130987 missense probably damaging 1.00
R3416:Adnp2 UTSW 18 80128158 missense possibly damaging 0.55
R3607:Adnp2 UTSW 18 80129069 missense probably damaging 1.00
R4012:Adnp2 UTSW 18 80130821 missense probably benign 0.01
R4260:Adnp2 UTSW 18 80137527 missense possibly damaging 0.85
R4588:Adnp2 UTSW 18 80128648 missense probably benign 0.22
R5158:Adnp2 UTSW 18 80137543 missense probably damaging 0.99
R5652:Adnp2 UTSW 18 80130850 missense probably damaging 1.00
R5717:Adnp2 UTSW 18 80128264 missense probably benign 0.13
R6743:Adnp2 UTSW 18 80128059 missense probably benign 0.00
R6786:Adnp2 UTSW 18 80129745 missense probably benign 0.03
R7105:Adnp2 UTSW 18 80128151 missense possibly damaging 0.94
R7507:Adnp2 UTSW 18 80130853 missense probably benign 0.22
R7620:Adnp2 UTSW 18 80130487 missense probably damaging 1.00
R7914:Adnp2 UTSW 18 80130841 missense probably damaging 0.96
R7991:Adnp2 UTSW 18 80129322 missense probably damaging 0.97
R8290:Adnp2 UTSW 18 80142733 missense probably damaging 1.00
R8366:Adnp2 UTSW 18 80130510 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTAACAGAGGGACCCATAGGC -3'
(R):5'- GTCAAAGCTCTGGCACTGTG -3'

Sequencing Primer
(F):5'- TAGGCAAGACAGCAGGCCC -3'
(R):5'- AGTCAGTGACTGTGACCCCAG -3'
Posted On2018-11-06