Incidental Mutation 'R6904:Olfr1141'
ID 538668
Institutional Source Beutler Lab
Gene Symbol Olfr1141
Ensembl Gene ENSMUSG00000075148
Gene Name olfactory receptor 1141
Synonyms MOR177-10, GA_x6K02T2Q125-49257818-49256883
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.151) question?
Stock # R6904 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 87753056-87753991 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 87753879 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 38 (V38A)
Ref Sequence ENSEMBL: ENSMUSP00000097433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099846]
AlphaFold Q8VFQ7
Predicted Effect probably benign
Transcript: ENSMUST00000099846
AA Change: V38A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097433
Gene: ENSMUSG00000075148
AA Change: V38A

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.8e-28 PFAM
Pfam:7tm_1 41 290 1.5e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,626,092 Y406* probably null Het
9530053A07Rik C T 7: 28,137,213 R186C probably damaging Het
Acadvl T C 11: 70,014,333 D109G probably benign Het
Adam24 G A 8: 40,681,503 G670E probably damaging Het
Angpt1 T C 15: 42,459,740 M378V probably benign Het
Ankrd33 G A 15: 101,117,112 probably null Het
Apol7b G A 15: 77,423,425 T290I probably benign Het
Atg4a-ps A G 3: 103,645,864 W54R probably damaging Het
B3glct A G 5: 149,739,604 probably null Het
Bmp7 A G 2: 172,872,913 S368P probably damaging Het
Boc A G 16: 44,491,791 V636A probably damaging Het
Cacna1i G A 15: 80,374,801 R1237H probably damaging Het
Cdcp1 T C 9: 123,173,915 D697G probably benign Het
Cep85l T C 10: 53,349,098 T132A probably benign Het
Ces1b T A 8: 93,060,410 Y447F probably damaging Het
Cntn4 A T 6: 106,697,583 T1015S probably benign Het
Eea1 T G 10: 96,002,879 probably null Het
Gm12800 G A 4: 101,910,094 C180Y possibly damaging Het
Gm4788 T G 1: 139,731,653 N642H possibly damaging Het
Hipk1 A T 3: 103,777,512 N262K possibly damaging Het
Jmjd8 G A 17: 25,829,052 R41H possibly damaging Het
Klhl3 T A 13: 58,030,445 T344S probably damaging Het
Krt39 T C 11: 99,519,821 D175G probably damaging Het
Map4k1 A G 7: 28,986,802 Y81C probably damaging Het
Mpdu1 T A 11: 69,658,585 T95S probably benign Het
Myl12b A T 17: 70,977,140 I31N probably damaging Het
Ndufaf5 T A 2: 140,188,780 Y195* probably null Het
Olfr1224-ps1 G A 2: 89,156,813 R121C possibly damaging Het
Olfr617 T A 7: 103,584,520 I166N possibly damaging Het
Olfr621-ps1 A T 7: 103,629,583 F126I probably benign Het
Olfr984 T C 9: 40,101,356 I45V probably benign Het
Oxgr1 T A 14: 120,022,019 I259F possibly damaging Het
Pcdhb9 T A 18: 37,401,917 D321E probably benign Het
Pi4kb G T 3: 94,993,150 R392L probably damaging Het
Prss41 T C 17: 23,837,648 K151R probably benign Het
Rev3l T A 10: 39,821,481 V658D probably benign Het
Snx4 A G 16: 33,294,738 I430V probably damaging Het
Tanc2 C T 11: 105,835,230 H407Y possibly damaging Het
Tcf25 G A 8: 123,400,698 probably null Het
Tsc22d1 A T 14: 76,506,483 K24* probably null Het
Vmn2r30 A G 7: 7,312,548 F762S probably damaging Het
Xrcc6 A G 15: 82,029,122 T319A probably benign Het
Zbtb1 C T 12: 76,386,211 R324* probably null Het
Zc3h7a A G 16: 11,145,671 Y729H probably damaging Het
Zfp329 C A 7: 12,806,530 probably benign Het
Zfp456 A T 13: 67,366,265 S441T probably benign Het
Other mutations in Olfr1141
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Olfr1141 APN 2 87753934 missense probably benign 0.00
IGL01412:Olfr1141 APN 2 87753117 missense probably damaging 1.00
IGL01533:Olfr1141 APN 2 87753068 missense probably benign 0.01
IGL02455:Olfr1141 APN 2 87753583 missense possibly damaging 0.95
IGL02698:Olfr1141 APN 2 87753844 nonsense probably null
PIT4480001:Olfr1141 UTSW 2 87753783 missense possibly damaging 0.95
R0543:Olfr1141 UTSW 2 87753650 missense probably damaging 1.00
R1542:Olfr1141 UTSW 2 87753318 missense probably damaging 0.99
R1750:Olfr1141 UTSW 2 87753186 missense probably damaging 0.97
R1844:Olfr1141 UTSW 2 87753990 start codon destroyed probably null 1.00
R2248:Olfr1141 UTSW 2 87753943 missense probably null 0.05
R4064:Olfr1141 UTSW 2 87753789 missense probably damaging 1.00
R5193:Olfr1141 UTSW 2 87753104 missense possibly damaging 0.59
R5861:Olfr1141 UTSW 2 87753578 missense probably benign 0.01
R6146:Olfr1141 UTSW 2 87753258 missense probably damaging 1.00
R6197:Olfr1141 UTSW 2 87753352 missense probably benign 0.15
R6481:Olfr1141 UTSW 2 87753468 missense probably damaging 1.00
R6857:Olfr1141 UTSW 2 87753487 missense probably damaging 1.00
R6962:Olfr1141 UTSW 2 87753727 missense probably benign
R7014:Olfr1141 UTSW 2 87753871 missense probably benign 0.00
R8229:Olfr1141 UTSW 2 87753064 missense probably benign 0.00
R8723:Olfr1141 UTSW 2 87753157 missense possibly damaging 0.69
R8883:Olfr1141 UTSW 2 87753494 missense probably damaging 1.00
R9129:Olfr1141 UTSW 2 87753704 missense probably benign 0.00
R9587:Olfr1141 UTSW 2 87753840 missense possibly damaging 0.79
R9665:Olfr1141 UTSW 2 87753327 missense probably damaging 0.97
T0722:Olfr1141 UTSW 2 87753123 missense probably damaging 1.00
Z1177:Olfr1141 UTSW 2 87753190 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CAACAATGGGATGGTTTTGTACTTG -3'
(R):5'- GGTCTCATGAATTGCAAAACCG -3'

Sequencing Primer
(F):5'- GCTGAAAATGTCTATCAACATCTTGG -3'
(R):5'- GCAAAACCGTTCAAGTTTCATC -3'
Posted On 2018-11-06