Incidental Mutation 'R6904:Ndufaf5'
ID538670
Institutional Source Beutler Lab
Gene Symbol Ndufaf5
Ensembl Gene ENSMUSG00000027384
Gene NameNADH dehydrogenase (ubiquinone) complex I, assembly factor 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.520) question?
Stock #R6904 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location140170649-140203689 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 140188780 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 195 (Y195*)
Ref Sequence ENSEMBL: ENSMUSP00000035325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044825]
Predicted Effect probably null
Transcript: ENSMUST00000044825
AA Change: Y195*
SMART Domains Protein: ENSMUSP00000035325
Gene: ENSMUSG00000027384
AA Change: Y195*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Methyltransf_29 45 196 7.1e-8 PFAM
Pfam:Methyltransf_23 53 239 6.4e-16 PFAM
Pfam:Ubie_methyltran 78 204 3e-10 PFAM
Pfam:Methyltransf_18 89 187 1.1e-8 PFAM
Pfam:Methyltransf_31 92 243 9.6e-13 PFAM
Pfam:Methyltransf_25 93 182 1.3e-9 PFAM
Pfam:Methyltransf_12 94 184 2.4e-14 PFAM
Pfam:Methyltransf_11 94 186 6.3e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The NADH-ubiquinone oxidoreductase complex (complex I) of the mitochondrial respiratory chain catalyzes the transfer of electrons from NADH to ubiquinone, and consists of at least 43 subunits. The complex is located in the inner mitochondrial membrane. This gene encodes a mitochondrial protein that is associated with the matrix face of the mitochondrial inner membrane and is required for complex I assembly. A mutation in this gene results in mitochondrial complex I deficiency. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,626,092 Y406* probably null Het
9530053A07Rik C T 7: 28,137,213 R186C probably damaging Het
Acadvl T C 11: 70,014,333 D109G probably benign Het
Adam24 G A 8: 40,681,503 G670E probably damaging Het
Angpt1 T C 15: 42,459,740 M378V probably benign Het
Ankrd33 G A 15: 101,117,112 probably null Het
Apol7b G A 15: 77,423,425 T290I probably benign Het
Atg4a-ps A G 3: 103,645,864 W54R probably damaging Het
B3glct A G 5: 149,739,604 probably null Het
Bmp7 A G 2: 172,872,913 S368P probably damaging Het
Boc A G 16: 44,491,791 V636A probably damaging Het
Cacna1i G A 15: 80,374,801 R1237H probably damaging Het
Cdcp1 T C 9: 123,173,915 D697G probably benign Het
Cep85l T C 10: 53,349,098 T132A probably benign Het
Ces1b T A 8: 93,060,410 Y447F probably damaging Het
Cntn4 A T 6: 106,697,583 T1015S probably benign Het
Eea1 T G 10: 96,002,879 probably null Het
Gm12800 G A 4: 101,910,094 C180Y possibly damaging Het
Gm4788 T G 1: 139,731,653 N642H possibly damaging Het
Hipk1 A T 3: 103,777,512 N262K possibly damaging Het
Jmjd8 G A 17: 25,829,052 R41H possibly damaging Het
Klhl3 T A 13: 58,030,445 T344S probably damaging Het
Krt39 T C 11: 99,519,821 D175G probably damaging Het
Map4k1 A G 7: 28,986,802 Y81C probably damaging Het
Mpdu1 T A 11: 69,658,585 T95S probably benign Het
Myl12b A T 17: 70,977,140 I31N probably damaging Het
Olfr1141 A G 2: 87,753,879 V38A probably benign Het
Olfr1224-ps1 G A 2: 89,156,813 R121C possibly damaging Het
Olfr617 T A 7: 103,584,520 I166N possibly damaging Het
Olfr621-ps1 A T 7: 103,629,583 F126I probably benign Het
Olfr984 T C 9: 40,101,356 I45V probably benign Het
Oxgr1 T A 14: 120,022,019 I259F possibly damaging Het
Pcdhb9 T A 18: 37,401,917 D321E probably benign Het
Pi4kb G T 3: 94,993,150 R392L probably damaging Het
Prss41 T C 17: 23,837,648 K151R probably benign Het
Rev3l T A 10: 39,821,481 V658D probably benign Het
Snx4 A G 16: 33,294,738 I430V probably damaging Het
Tanc2 C T 11: 105,835,230 H407Y possibly damaging Het
Tcf25 G A 8: 123,400,698 probably null Het
Tsc22d1 A T 14: 76,506,483 K24* probably null Het
Vmn2r30 A G 7: 7,312,548 F762S probably damaging Het
Xrcc6 A G 15: 82,029,122 T319A probably benign Het
Zbtb1 C T 12: 76,386,211 R324* probably null Het
Zc3h7a A G 16: 11,145,671 Y729H probably damaging Het
Zfp329 C A 7: 12,806,530 probably benign Het
Zfp456 A T 13: 67,366,265 S441T probably benign Het
Other mutations in Ndufaf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02192:Ndufaf5 APN 2 140188743 missense probably benign 0.01
R0373:Ndufaf5 UTSW 2 140170881 missense probably benign 0.03
R1654:Ndufaf5 UTSW 2 140177300 splice site probably null
R1710:Ndufaf5 UTSW 2 140193602 missense possibly damaging 0.92
R1868:Ndufaf5 UTSW 2 140181589 missense probably benign 0.00
R2226:Ndufaf5 UTSW 2 140188860 missense probably benign 0.02
R3794:Ndufaf5 UTSW 2 140202923 missense possibly damaging 0.89
R4440:Ndufaf5 UTSW 2 140170725 missense probably benign 0.00
R4621:Ndufaf5 UTSW 2 140183925 missense probably benign 0.02
R4669:Ndufaf5 UTSW 2 140187755 missense probably benign 0.11
R5683:Ndufaf5 UTSW 2 140202923 missense possibly damaging 0.89
R6937:Ndufaf5 UTSW 2 140181602 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGGGAGTGTCCTGTCTG -3'
(R):5'- GTAGGCTACTTGTGGACTACTTAG -3'

Sequencing Primer
(F):5'- CATACATCATAGAGCAGTGACTCTAG -3'
(R):5'- GTGGACTACTTAGTTCTCCTGATAC -3'
Posted On2018-11-06