Incidental Mutation 'R6904:2610021A01Rik'
ID538682
Institutional Source Beutler Lab
Gene Symbol 2610021A01Rik
Ensembl Gene ENSMUSG00000091474
Gene NameRIKEN cDNA 2610021A01 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R6904 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location41599230-41628533 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 41626092 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 406 (Y406*)
Ref Sequence ENSEMBL: ENSMUSP00000127760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163475]
Predicted Effect probably null
Transcript: ENSMUST00000163475
AA Change: Y406*
SMART Domains Protein: ENSMUSP00000127760
Gene: ENSMUSG00000091474
AA Change: Y406*

DomainStartEndE-ValueType
KRAB 18 78 1.32e-32 SMART
ZnF_C2H2 415 437 4.54e-4 SMART
ZnF_C2H2 443 465 3.69e-4 SMART
ZnF_C2H2 471 493 5.14e-3 SMART
ZnF_C2H2 499 521 4.94e-5 SMART
ZnF_C2H2 527 549 3.16e-3 SMART
ZnF_C2H2 555 577 3.16e-3 SMART
ZnF_C2H2 583 605 8.6e-5 SMART
ZnF_C2H2 611 633 1.79e-2 SMART
ZnF_C2H2 639 661 2.43e-4 SMART
ZnF_C2H2 667 689 1.72e-4 SMART
ZnF_C2H2 695 717 9.73e-4 SMART
ZnF_C2H2 723 745 2.02e-1 SMART
ZnF_C2H2 751 773 1.69e-3 SMART
ZnF_C2H2 779 801 3.69e-4 SMART
ZnF_C2H2 807 829 7.37e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,137,213 R186C probably damaging Het
Acadvl T C 11: 70,014,333 D109G probably benign Het
Adam24 G A 8: 40,681,503 G670E probably damaging Het
Angpt1 T C 15: 42,459,740 M378V probably benign Het
Ankrd33 G A 15: 101,117,112 probably null Het
Apol7b G A 15: 77,423,425 T290I probably benign Het
Atg4a-ps A G 3: 103,645,864 W54R probably damaging Het
B3glct A G 5: 149,739,604 probably null Het
Bmp7 A G 2: 172,872,913 S368P probably damaging Het
Boc A G 16: 44,491,791 V636A probably damaging Het
Cacna1i G A 15: 80,374,801 R1237H probably damaging Het
Cdcp1 T C 9: 123,173,915 D697G probably benign Het
Cep85l T C 10: 53,349,098 T132A probably benign Het
Ces1b T A 8: 93,060,410 Y447F probably damaging Het
Cntn4 A T 6: 106,697,583 T1015S probably benign Het
Eea1 T G 10: 96,002,879 probably null Het
Gm12800 G A 4: 101,910,094 C180Y possibly damaging Het
Gm4788 T G 1: 139,731,653 N642H possibly damaging Het
Hipk1 A T 3: 103,777,512 N262K possibly damaging Het
Jmjd8 G A 17: 25,829,052 R41H possibly damaging Het
Klhl3 T A 13: 58,030,445 T344S probably damaging Het
Krt39 T C 11: 99,519,821 D175G probably damaging Het
Map4k1 A G 7: 28,986,802 Y81C probably damaging Het
Mpdu1 T A 11: 69,658,585 T95S probably benign Het
Myl12b A T 17: 70,977,140 I31N probably damaging Het
Ndufaf5 T A 2: 140,188,780 Y195* probably null Het
Olfr1141 A G 2: 87,753,879 V38A probably benign Het
Olfr1224-ps1 G A 2: 89,156,813 R121C possibly damaging Het
Olfr617 T A 7: 103,584,520 I166N possibly damaging Het
Olfr621-ps1 A T 7: 103,629,583 F126I probably benign Het
Olfr984 T C 9: 40,101,356 I45V probably benign Het
Oxgr1 T A 14: 120,022,019 I259F possibly damaging Het
Pcdhb9 T A 18: 37,401,917 D321E probably benign Het
Pi4kb G T 3: 94,993,150 R392L probably damaging Het
Prss41 T C 17: 23,837,648 K151R probably benign Het
Rev3l T A 10: 39,821,481 V658D probably benign Het
Snx4 A G 16: 33,294,738 I430V probably damaging Het
Tanc2 C T 11: 105,835,230 H407Y possibly damaging Het
Tcf25 G A 8: 123,400,698 probably null Het
Tsc22d1 A T 14: 76,506,483 K24* probably null Het
Vmn2r30 A G 7: 7,312,548 F762S probably damaging Het
Xrcc6 A G 15: 82,029,122 T319A probably benign Het
Zbtb1 C T 12: 76,386,211 R324* probably null Het
Zc3h7a A G 16: 11,145,671 Y729H probably damaging Het
Zfp329 C A 7: 12,806,530 probably benign Het
Zfp456 A T 13: 67,366,265 S441T probably benign Het
Other mutations in 2610021A01Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:2610021A01Rik APN 7 41625572 missense possibly damaging 0.61
IGL00566:2610021A01Rik APN 7 41625391 missense possibly damaging 0.53
R0940:2610021A01Rik UTSW 7 41626434 missense probably damaging 1.00
R1101:2610021A01Rik UTSW 7 41627359 missense probably damaging 1.00
R1180:2610021A01Rik UTSW 7 41625717 missense probably benign 0.41
R1560:2610021A01Rik UTSW 7 41626042 missense probably benign 0.09
R1740:2610021A01Rik UTSW 7 41626125 nonsense probably null
R1988:2610021A01Rik UTSW 7 41626657 nonsense probably null
R2041:2610021A01Rik UTSW 7 41625979 missense possibly damaging 0.63
R2964:2610021A01Rik UTSW 7 41626405 nonsense probably null
R2965:2610021A01Rik UTSW 7 41626405 nonsense probably null
R2966:2610021A01Rik UTSW 7 41626405 nonsense probably null
R4002:2610021A01Rik UTSW 7 41625540 missense possibly damaging 0.83
R4569:2610021A01Rik UTSW 7 41625838 missense probably benign 0.04
R4708:2610021A01Rik UTSW 7 41611885 missense probably damaging 1.00
R4880:2610021A01Rik UTSW 7 41627105 missense possibly damaging 0.47
R4933:2610021A01Rik UTSW 7 41626802 missense probably damaging 0.98
R5036:2610021A01Rik UTSW 7 41626154 missense possibly damaging 0.92
R5206:2610021A01Rik UTSW 7 41626585 nonsense probably null
R5235:2610021A01Rik UTSW 7 41624832 missense possibly damaging 0.53
R6449:2610021A01Rik UTSW 7 41625874 nonsense probably null
R6488:2610021A01Rik UTSW 7 41625874 nonsense probably null
R7058:2610021A01Rik UTSW 7 41626130 missense possibly damaging 0.61
R7157:2610021A01Rik UTSW 7 41626976 missense probably damaging 1.00
R7392:2610021A01Rik UTSW 7 41626566 missense probably damaging 1.00
R7589:2610021A01Rik UTSW 7 41626972 missense probably damaging 1.00
R7648:2610021A01Rik UTSW 7 41612462 missense possibly damaging 0.51
R7785:2610021A01Rik UTSW 7 41613193 missense probably benign
X0067:2610021A01Rik UTSW 7 41627317 missense probably benign 0.09
Z1176:2610021A01Rik UTSW 7 41625342 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- CCTTCGAAACTTGTTGGGCATC -3'
(R):5'- GCCTTGCCACAATCTGTACATTTG -3'

Sequencing Primer
(F):5'- AAACTTGTTGGGCATCCGAGATTC -3'
(R):5'- GTAAGGTTTCTCTCCAGTATGAAGCC -3'
Posted On2018-11-06