Mutagenetix > Incidental Mutation

Incidental Mutation 'R6904:Rev3l'

538690

Institutional Source

Beutler Lab

Gene Symbol

Rev3l

Ensembl Gene

ENSMUSG00000019841

Gene Name

REV3 like, DNA directed polymerase zeta catalytic subunit

Synonyms

Sez4, Rev

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6904 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

39732118-39875211 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 39821481 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 658 (V658D)

Ref Sequence

ENSEMBL: ENSMUSP00000131519 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019986] [ENSMUST00000131186] [ENSMUST00000139803] [ENSMUST00000164763]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000019986
AA Change: V658D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000019986
Gene: ENSMUSG00000019841
AA Change: V658D

Domain	Start	End	E-Value	Type
Pfam:DNA_pol_B_exo1	43	201	1.6e-10	PFAM
low complexity region	494	506	N/A	INTRINSIC
low complexity region	959	969	N/A	INTRINSIC
low complexity region	1042	1057	N/A	INTRINSIC
low complexity region	1205	1216	N/A	INTRINSIC
low complexity region	1424	1440	N/A	INTRINSIC
low complexity region	1569	1595	N/A	INTRINSIC
Blast:POLBc	1825	2243	1e-163	BLAST
PDB:4GK5\|D	1863	1895	4e-13	PDB
POLBc	2308	2783	5.32e-105	SMART
Blast:POLBc	2860	2926	2e-14	BLAST
Pfam:zf-C4pol	3034	3103	8.2e-16	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000131186

Predicted Effect

probably benign
Transcript: ENSMUST00000139803

SMART Domains

Protein: ENSMUSP00000115630
Gene: ENSMUSG00000019841

Domain	Start	End	E-Value	Type
Blast:POLBc	1	369	1e-155	BLAST
POLBc	434	805	4.77e-34	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000164763
AA Change: V658D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000131519
Gene: ENSMUSG00000019841
AA Change: V658D

Domain	Start	End	E-Value	Type
Pfam:DNA_pol_B_exo1	43	200	1.3e-11	PFAM
low complexity region	494	506	N/A	INTRINSIC
Pfam:DUF4683	745	1132	1.7e-162	PFAM
low complexity region	1205	1216	N/A	INTRINSIC
low complexity region	1424	1440	N/A	INTRINSIC
low complexity region	1569	1595	N/A	INTRINSIC
Blast:POLBc	1825	2243	1e-163	BLAST
PDB:4GK5\|D	1863	1895	4e-13	PDB
POLBc	2308	2783	5.32e-105	SMART
Blast:POLBc	2860	2926	2e-14	BLAST
Pfam:zf-C4pol	3034	3102	6.1e-15	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene represents the catalytic subunit of DNA polymerase zeta, which functions in translesion DNA synthesis. The encoded protein can be found in mitochondria, where it protects DNA from damage. Defects in this gene are a cause of Mobius syndrome. [provided by RefSeq, Jan 2017]
PHENOTYPE: Nullizygous mice exhibit complete embryonic lethality and abnormal embryonic tissue morphology with widespread degeneration and cell death. Mice carrying the amino acid substitution of phenylalanine for leucine at position 2610 display alterations in somatic hypermutation frequency and specificity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610021A01Rik	T	A	7: 41,626,092	Y406*	probably null	Het
9530053A07Rik	C	T	7: 28,137,213	R186C	probably damaging	Het
Acadvl	T	C	11: 70,014,333	D109G	probably benign	Het
Adam24	G	A	8: 40,681,503	G670E	probably damaging	Het
Angpt1	T	C	15: 42,459,740	M378V	probably benign	Het
Ankrd33	G	A	15: 101,117,112		probably null	Het
Apol7b	G	A	15: 77,423,425	T290I	probably benign	Het
Atg4a-ps	A	G	3: 103,645,864	W54R	probably damaging	Het
B3glct	A	G	5: 149,739,604		probably null	Het
Bmp7	A	G	2: 172,872,913	S368P	probably damaging	Het
Boc	A	G	16: 44,491,791	V636A	probably damaging	Het
Cacna1i	G	A	15: 80,374,801	R1237H	probably damaging	Het
Cdcp1	T	C	9: 123,173,915	D697G	probably benign	Het
Cep85l	T	C	10: 53,349,098	T132A	probably benign	Het
Ces1b	T	A	8: 93,060,410	Y447F	probably damaging	Het
Cntn4	A	T	6: 106,697,583	T1015S	probably benign	Het
Eea1	T	G	10: 96,002,879		probably null	Het
Gm12800	G	A	4: 101,910,094	C180Y	possibly damaging	Het
Gm4788	T	G	1: 139,731,653	N642H	possibly damaging	Het
Hipk1	A	T	3: 103,777,512	N262K	possibly damaging	Het
Jmjd8	G	A	17: 25,829,052	R41H	possibly damaging	Het
Klhl3	T	A	13: 58,030,445	T344S	probably damaging	Het
Krt39	T	C	11: 99,519,821	D175G	probably damaging	Het
Map4k1	A	G	7: 28,986,802	Y81C	probably damaging	Het
Mpdu1	T	A	11: 69,658,585	T95S	probably benign	Het
Myl12b	A	T	17: 70,977,140	I31N	probably damaging	Het
Ndufaf5	T	A	2: 140,188,780	Y195*	probably null	Het
Olfr1141	A	G	2: 87,753,879	V38A	probably benign	Het
Olfr1224-ps1	G	A	2: 89,156,813	R121C	possibly damaging	Het
Olfr617	T	A	7: 103,584,520	I166N	possibly damaging	Het
Olfr621-ps1	A	T	7: 103,629,583	F126I	probably benign	Het
Olfr984	T	C	9: 40,101,356	I45V	probably benign	Het
Oxgr1	T	A	14: 120,022,019	I259F	possibly damaging	Het
Pcdhb9	T	A	18: 37,401,917	D321E	probably benign	Het
Pi4kb	G	T	3: 94,993,150	R392L	probably damaging	Het
Prss41	T	C	17: 23,837,648	K151R	probably benign	Het
Snx4	A	G	16: 33,294,738	I430V	probably damaging	Het
Tanc2	C	T	11: 105,835,230	H407Y	possibly damaging	Het
Tcf25	G	A	8: 123,400,698		probably null	Het
Tsc22d1	A	T	14: 76,506,483	K24*	probably null	Het
Vmn2r30	A	G	7: 7,312,548	F762S	probably damaging	Het
Xrcc6	A	G	15: 82,029,122	T319A	probably benign	Het
Zbtb1	C	T	12: 76,386,211	R324*	probably null	Het
Zc3h7a	A	G	16: 11,145,671	Y729H	probably damaging	Het
Zfp329	C	A	7: 12,806,530		probably benign	Het
Zfp456	A	T	13: 67,366,265	S441T	probably benign	Het

Other mutations in Rev3l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Rev3l	APN	10	39806969	missense	probably benign
IGL00815:Rev3l	APN	10	39859153	missense	possibly damaging	0.79
IGL00964:Rev3l	APN	10	39864806	missense	probably benign	0.39
IGL01765:Rev3l	APN	10	39828265	missense	probably benign	0.00
IGL01792:Rev3l	APN	10	39823340	missense	probably benign
IGL01950:Rev3l	APN	10	39821157	missense	probably damaging	1.00
IGL01963:Rev3l	APN	10	39822737	missense	possibly damaging	0.90
IGL02089:Rev3l	APN	10	39825099	missense	probably damaging	1.00
IGL02288:Rev3l	APN	10	39828216	missense	probably benign
IGL02381:Rev3l	APN	10	39821346	missense	possibly damaging	0.83
IGL02409:Rev3l	APN	10	39821148	missense	possibly damaging	0.75
IGL02434:Rev3l	APN	10	39822591	missense	probably damaging	1.00
IGL02570:Rev3l	APN	10	39848013	missense	possibly damaging	0.68
IGL02581:Rev3l	APN	10	39821281	missense	probably benign	0.10
IGL02654:Rev3l	APN	10	39862734	missense	probably damaging	1.00
IGL02720:Rev3l	APN	10	39822395	nonsense	probably null
IGL02746:Rev3l	APN	10	39824589	missense	probably damaging	0.99
IGL02829:Rev3l	APN	10	39825240	missense	probably damaging	1.00
IGL02961:Rev3l	APN	10	39827945	missense	possibly damaging	0.65
IGL02974:Rev3l	APN	10	39862747	nonsense	probably null
IGL03029:Rev3l	APN	10	39828486	missense	probably benign	0.34
IGL03153:Rev3l	APN	10	39806878	missense	probably damaging	1.00
IGL03172:Rev3l	APN	10	39824790	missense	probably benign	0.10
R0068:Rev3l	UTSW	10	39824831	missense	possibly damaging	0.68
R0068:Rev3l	UTSW	10	39824831	missense	possibly damaging	0.68
R0153:Rev3l	UTSW	10	39874128	nonsense	probably null
R0308:Rev3l	UTSW	10	39824894	missense	probably benign	0.09
R0355:Rev3l	UTSW	10	39817286	missense	probably damaging	1.00
R0513:Rev3l	UTSW	10	39828143	missense	probably benign	0.00
R0523:Rev3l	UTSW	10	39848049	missense	probably benign	0.02
R0559:Rev3l	UTSW	10	39824487	missense	probably damaging	1.00
R0761:Rev3l	UTSW	10	39874195	missense	probably benign	0.32
R1023:Rev3l	UTSW	10	39832639	missense	probably damaging	1.00
R1159:Rev3l	UTSW	10	39851925	nonsense	probably null
R1398:Rev3l	UTSW	10	39821583	missense	probably benign	0.05
R1478:Rev3l	UTSW	10	39783333	critical splice donor site	probably null
R1517:Rev3l	UTSW	10	39838443	missense	probably benign	0.34
R1527:Rev3l	UTSW	10	39822822	missense	probably damaging	1.00
R1635:Rev3l	UTSW	10	39806662	missense	probably damaging	0.98
R1695:Rev3l	UTSW	10	39824615	nonsense	probably null
R1695:Rev3l	UTSW	10	39824616	missense	probably damaging	0.97
R1782:Rev3l	UTSW	10	39799885	missense	probably benign
R1815:Rev3l	UTSW	10	39822871	missense	probably benign	0.41
R1818:Rev3l	UTSW	10	39828424	missense	probably benign	0.05
R2039:Rev3l	UTSW	10	39824444	missense	probably damaging	1.00
R2071:Rev3l	UTSW	10	39824353	missense	probably benign	0.17
R2101:Rev3l	UTSW	10	39828096	missense	probably benign	0.00
R2141:Rev3l	UTSW	10	39848049	missense	probably benign	0.02
R2883:Rev3l	UTSW	10	39825156	missense	probably damaging	1.00
R3787:Rev3l	UTSW	10	39846210	missense	probably damaging	0.97
R3910:Rev3l	UTSW	10	39820556	missense	probably damaging	1.00
R3912:Rev3l	UTSW	10	39820556	missense	probably damaging	1.00
R3913:Rev3l	UTSW	10	39820556	missense	probably damaging	1.00
R4590:Rev3l	UTSW	10	39806933	missense	probably damaging	1.00
R4631:Rev3l	UTSW	10	39828416	missense	probably benign	0.44
R4633:Rev3l	UTSW	10	39846186	missense	probably damaging	1.00
R4707:Rev3l	UTSW	10	39823397	missense	probably damaging	0.99
R4724:Rev3l	UTSW	10	39846806	nonsense	probably null
R4810:Rev3l	UTSW	10	39823725	missense	probably benign	0.01
R4857:Rev3l	UTSW	10	39838459	missense	probably damaging	1.00
R4882:Rev3l	UTSW	10	39821460	missense	possibly damaging	0.89
R4928:Rev3l	UTSW	10	39823985	missense	probably benign	0.30
R4970:Rev3l	UTSW	10	39823330	missense	probably benign	0.00
R4977:Rev3l	UTSW	10	39823578	missense	possibly damaging	0.80
R5112:Rev3l	UTSW	10	39823330	missense	probably benign	0.00
R5261:Rev3l	UTSW	10	39846729	missense	probably damaging	1.00
R5419:Rev3l	UTSW	10	39824931	missense	possibly damaging	0.95
R5570:Rev3l	UTSW	10	39852075	critical splice donor site	probably null
R5628:Rev3l	UTSW	10	39822967	missense	probably damaging	0.98
R5689:Rev3l	UTSW	10	39794958	missense	probably damaging	1.00
R5781:Rev3l	UTSW	10	39823093	missense	probably benign	0.00
R5829:Rev3l	UTSW	10	39806906	missense	probably damaging	0.97
R5984:Rev3l	UTSW	10	39742689	intron	probably benign
R5990:Rev3l	UTSW	10	39823811	missense	probably benign	0.17
R6054:Rev3l	UTSW	10	39824150	missense	probably benign	0.01
R6171:Rev3l	UTSW	10	39862713	nonsense	probably null
R6220:Rev3l	UTSW	10	39822779	missense	probably damaging	1.00
R6520:Rev3l	UTSW	10	39822702	missense	probably benign	0.06
R6798:Rev3l	UTSW	10	39854763	missense	probably damaging	1.00
R6811:Rev3l	UTSW	10	39830921	nonsense	probably null
R6812:Rev3l	UTSW	10	39823548	missense	probably benign
R6905:Rev3l	UTSW	10	39817327	missense	probably benign	0.18
R6938:Rev3l	UTSW	10	39862710	missense	probably damaging	1.00
R7037:Rev3l	UTSW	10	39851975	missense	probably damaging	1.00
R7124:Rev3l	UTSW	10	39822167	nonsense	probably null
R7286:Rev3l	UTSW	10	39823605	missense	probably damaging	0.99
R7385:Rev3l	UTSW	10	39823682	missense	probably benign	0.01
R7575:Rev3l	UTSW	10	39821445	missense	possibly damaging	0.56
R7596:Rev3l	UTSW	10	39821538	missense	probably damaging	1.00
R7597:Rev3l	UTSW	10	39822884	missense	probably damaging	1.00
R7670:Rev3l	UTSW	10	39836722	missense	probably benign	0.01
R7804:Rev3l	UTSW	10	39823485	missense	probably benign	0.34
R7818:Rev3l	UTSW	10	39823902	missense	possibly damaging	0.54
R7874:Rev3l	UTSW	10	39822495	missense	possibly damaging	0.72
R7991:Rev3l	UTSW	10	39863738	missense	possibly damaging	0.52
R8059:Rev3l	UTSW	10	39843495	missense	probably damaging	1.00
R8174:Rev3l	UTSW	10	39859115	missense	probably damaging	1.00
R8187:Rev3l	UTSW	10	39806697	missense	probably benign
R8299:Rev3l	UTSW	10	39821541	missense	probably benign	0.01
R8352:Rev3l	UTSW	10	39822903	missense	probably damaging	1.00
R8452:Rev3l	UTSW	10	39822903	missense	probably damaging	1.00
R8468:Rev3l	UTSW	10	39827991	missense	probably damaging	0.99
R8487:Rev3l	UTSW	10	39806848	missense	probably damaging	1.00
R8512:Rev3l	UTSW	10	39821538	missense	probably damaging	1.00
R8554:Rev3l	UTSW	10	39806842	missense	probably benign	0.12
R8702:Rev3l	UTSW	10	39838469	nonsense	probably null
R8848:Rev3l	UTSW	10	39846709	missense	probably damaging	0.99
R8857:Rev3l	UTSW	10	39794969	nonsense	probably null
R8870:Rev3l	UTSW	10	39862790	missense	probably damaging	1.00
R9094:Rev3l	UTSW	10	39824813	missense	probably benign
R9175:Rev3l	UTSW	10	39854768	missense	possibly damaging	0.83
R9286:Rev3l	UTSW	10	39806951	missense	possibly damaging	0.54
R9299:Rev3l	UTSW	10	39848003	missense	probably damaging	1.00
R9307:Rev3l	UTSW	10	39817153	missense	probably benign	0.01
R9337:Rev3l	UTSW	10	39822854	missense	probably benign	0.40
R9342:Rev3l	UTSW	10	39821462	missense	probably benign
R9389:Rev3l	UTSW	10	39822971	missense	possibly damaging	0.47
R9395:Rev3l	UTSW	10	39859223	critical splice donor site	probably null
R9458:Rev3l	UTSW	10	39783251	missense	probably damaging	1.00
R9481:Rev3l	UTSW	10	39825037	missense	probably benign
R9646:Rev3l	UTSW	10	39822444	missense	probably damaging	1.00
R9686:Rev3l	UTSW	10	39867388	missense	possibly damaging	0.67
X0022:Rev3l	UTSW	10	39828607	critical splice donor site	probably null
Z1088:Rev3l	UTSW	10	39824318	missense	probably benign	0.41

Predicted Primers

PCR Primer
(F):5'- GGTTTAACTGAAGACCTTTCACAAC -3'
(R):5'- ACACCACTGAGAGATGTGCTG -3'

Sequencing Primer
(F):5'- CCAAACAGTACAGAAAAAGGTCG -3'
(R):5'- ACCACTGAGAGATGTGCTGTTTCC -3'

Posted On

2018-11-06