Incidental Mutation 'R6904:Zfp456'
ID538699
Institutional Source Beutler Lab
Gene Symbol Zfp456
Ensembl Gene ENSMUSG00000078995
Gene Namezinc finger protein 456
SynonymsRslcan-13
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R6904 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location67362113-67375810 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67366265 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 441 (S441T)
Ref Sequence ENSEMBL: ENSMUSP00000059686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057070] [ENSMUST00000166080] [ENSMUST00000172266]
Predicted Effect probably benign
Transcript: ENSMUST00000057070
AA Change: S441T

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000059686
Gene: ENSMUSG00000078995
AA Change: S441T

DomainStartEndE-ValueType
KRAB 2 62 3.07e-33 SMART
ZnF_C2H2 106 128 1.92e-2 SMART
ZnF_C2H2 134 156 5.77e0 SMART
ZnF_C2H2 162 184 1.28e-3 SMART
ZnF_C2H2 190 212 2.36e-2 SMART
ZnF_C2H2 246 268 2.17e-1 SMART
ZnF_C2H2 274 296 7.37e-4 SMART
ZnF_C2H2 302 324 6.32e-3 SMART
ZnF_C2H2 330 352 2.4e-3 SMART
ZnF_C2H2 358 380 8.94e-3 SMART
ZnF_C2H2 386 408 1.92e-2 SMART
ZnF_C2H2 414 436 7.9e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166080
SMART Domains Protein: ENSMUSP00000126669
Gene: ENSMUSG00000098692

DomainStartEndE-ValueType
KRAB 2 62 3.07e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172266
SMART Domains Protein: ENSMUSP00000130928
Gene: ENSMUSG00000078995

DomainStartEndE-ValueType
KRAB 2 62 3.07e-33 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,626,092 Y406* probably null Het
9530053A07Rik C T 7: 28,137,213 R186C probably damaging Het
Acadvl T C 11: 70,014,333 D109G probably benign Het
Adam24 G A 8: 40,681,503 G670E probably damaging Het
Angpt1 T C 15: 42,459,740 M378V probably benign Het
Ankrd33 G A 15: 101,117,112 probably null Het
Apol7b G A 15: 77,423,425 T290I probably benign Het
Atg4a-ps A G 3: 103,645,864 W54R probably damaging Het
B3glct A G 5: 149,739,604 probably null Het
Bmp7 A G 2: 172,872,913 S368P probably damaging Het
Boc A G 16: 44,491,791 V636A probably damaging Het
Cacna1i G A 15: 80,374,801 R1237H probably damaging Het
Cdcp1 T C 9: 123,173,915 D697G probably benign Het
Cep85l T C 10: 53,349,098 T132A probably benign Het
Ces1b T A 8: 93,060,410 Y447F probably damaging Het
Cntn4 A T 6: 106,697,583 T1015S probably benign Het
Eea1 T G 10: 96,002,879 probably null Het
Gm12800 G A 4: 101,910,094 C180Y possibly damaging Het
Gm4788 T G 1: 139,731,653 N642H possibly damaging Het
Hipk1 A T 3: 103,777,512 N262K possibly damaging Het
Jmjd8 G A 17: 25,829,052 R41H possibly damaging Het
Klhl3 T A 13: 58,030,445 T344S probably damaging Het
Krt39 T C 11: 99,519,821 D175G probably damaging Het
Map4k1 A G 7: 28,986,802 Y81C probably damaging Het
Mpdu1 T A 11: 69,658,585 T95S probably benign Het
Myl12b A T 17: 70,977,140 I31N probably damaging Het
Ndufaf5 T A 2: 140,188,780 Y195* probably null Het
Olfr1141 A G 2: 87,753,879 V38A probably benign Het
Olfr1224-ps1 G A 2: 89,156,813 R121C possibly damaging Het
Olfr617 T A 7: 103,584,520 I166N possibly damaging Het
Olfr621-ps1 A T 7: 103,629,583 F126I probably benign Het
Olfr984 T C 9: 40,101,356 I45V probably benign Het
Oxgr1 T A 14: 120,022,019 I259F possibly damaging Het
Pcdhb9 T A 18: 37,401,917 D321E probably benign Het
Pi4kb G T 3: 94,993,150 R392L probably damaging Het
Prss41 T C 17: 23,837,648 K151R probably benign Het
Rev3l T A 10: 39,821,481 V658D probably benign Het
Snx4 A G 16: 33,294,738 I430V probably damaging Het
Tanc2 C T 11: 105,835,230 H407Y possibly damaging Het
Tcf25 G A 8: 123,400,698 probably null Het
Tsc22d1 A T 14: 76,506,483 K24* probably null Het
Vmn2r30 A G 7: 7,312,548 F762S probably damaging Het
Xrcc6 A G 15: 82,029,122 T319A probably benign Het
Zbtb1 C T 12: 76,386,211 R324* probably null Het
Zc3h7a A G 16: 11,145,671 Y729H probably damaging Het
Zfp329 C A 7: 12,806,530 probably benign Het
Other mutations in Zfp456
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01769:Zfp456 APN 13 67367153 missense probably benign 0.06
IGL03200:Zfp456 APN 13 67366477 missense probably benign
IGL03406:Zfp456 APN 13 67366331 missense probably damaging 0.98
R0667:Zfp456 UTSW 13 67366742 missense probably benign 0.00
R0729:Zfp456 UTSW 13 67366544 missense probably damaging 1.00
R1731:Zfp456 UTSW 13 67366555 missense probably benign 0.39
R1832:Zfp456 UTSW 13 67367363 missense probably benign 0.09
R2011:Zfp456 UTSW 13 67366874 nonsense probably null
R2022:Zfp456 UTSW 13 67366497 nonsense probably null
R2023:Zfp456 UTSW 13 67366497 nonsense probably null
R2438:Zfp456 UTSW 13 67366954 missense probably damaging 1.00
R2516:Zfp456 UTSW 13 67362372 missense probably benign 0.00
R2896:Zfp456 UTSW 13 67367297 missense possibly damaging 0.52
R3964:Zfp456 UTSW 13 67366781 missense probably benign 0.03
R4930:Zfp456 UTSW 13 67366946 missense probably benign
R4971:Zfp456 UTSW 13 67366876 missense probably benign 0.31
R5357:Zfp456 UTSW 13 67372209 missense possibly damaging 0.71
R5754:Zfp456 UTSW 13 67366240 missense probably benign 0.40
R5795:Zfp456 UTSW 13 67366920 missense probably benign
R6339:Zfp456 UTSW 13 67362364 nonsense probably null
R7071:Zfp456 UTSW 13 67372777 missense probably damaging 1.00
R7690:Zfp456 UTSW 13 67366794 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGTTCTGCTTTATGCCTGTAG -3'
(R):5'- GAAGACTGTGGCAGATGTTTC -3'

Sequencing Primer
(F):5'- CACACTATAGAACACATTGGTTGGG -3'
(R):5'- TGCAAGTCTTCAGGAGCATC -3'
Posted On2018-11-06