Incidental Mutation 'R6904:Tsc22d1'
ID538700
Institutional Source Beutler Lab
Gene Symbol Tsc22d1
Ensembl Gene ENSMUSG00000022010
Gene NameTSC22 domain family, member 1
SynonymsTSC-22, Tgfb1i4, Egr5
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.317) question?
Stock #R6904 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location76414961-76507765 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 76506483 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 24 (K24*)
Ref Sequence ENSEMBL: ENSMUSP00000135296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022587] [ENSMUST00000048371] [ENSMUST00000101618] [ENSMUST00000110888] [ENSMUST00000133224] [ENSMUST00000134109] [ENSMUST00000140251] [ENSMUST00000142683] [ENSMUST00000177207]
Predicted Effect probably null
Transcript: ENSMUST00000022587
AA Change: K81*
SMART Domains Protein: ENSMUSP00000022587
Gene: ENSMUSG00000022010
AA Change: K81*

DomainStartEndE-ValueType
Pfam:TSC22 58 117 3.2e-35 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000048371
AA Change: K1015*
SMART Domains Protein: ENSMUSP00000044517
Gene: ENSMUSG00000022010
AA Change: K1015*

DomainStartEndE-ValueType
low complexity region 32 47 N/A INTRINSIC
low complexity region 59 96 N/A INTRINSIC
low complexity region 121 132 N/A INTRINSIC
low complexity region 191 208 N/A INTRINSIC
low complexity region 216 241 N/A INTRINSIC
low complexity region 246 257 N/A INTRINSIC
low complexity region 266 289 N/A INTRINSIC
low complexity region 461 489 N/A INTRINSIC
low complexity region 497 521 N/A INTRINSIC
low complexity region 537 556 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
low complexity region 673 687 N/A INTRINSIC
low complexity region 702 724 N/A INTRINSIC
low complexity region 933 970 N/A INTRINSIC
Pfam:TSC22 992 1048 7e-31 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000101618
AA Change: K45*
SMART Domains Protein: ENSMUSP00000099140
Gene: ENSMUSG00000022010
AA Change: K45*

DomainStartEndE-ValueType
Pfam:TSC22 22 81 1e-35 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110888
AA Change: K933*
SMART Domains Protein: ENSMUSP00000106513
Gene: ENSMUSG00000022010
AA Change: K933*

DomainStartEndE-ValueType
low complexity region 32 47 N/A INTRINSIC
low complexity region 59 96 N/A INTRINSIC
low complexity region 121 132 N/A INTRINSIC
low complexity region 191 208 N/A INTRINSIC
low complexity region 216 241 N/A INTRINSIC
low complexity region 246 257 N/A INTRINSIC
low complexity region 266 289 N/A INTRINSIC
low complexity region 379 407 N/A INTRINSIC
low complexity region 415 439 N/A INTRINSIC
low complexity region 455 474 N/A INTRINSIC
internal_repeat_1 502 536 8.43e-5 PROSPERO
low complexity region 537 555 N/A INTRINSIC
low complexity region 591 605 N/A INTRINSIC
low complexity region 620 642 N/A INTRINSIC
internal_repeat_1 644 676 8.43e-5 PROSPERO
low complexity region 851 888 N/A INTRINSIC
Pfam:TSC22 910 969 4.7e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000133224
AA Change: K24*
SMART Domains Protein: ENSMUSP00000135561
Gene: ENSMUSG00000022010
AA Change: K24*

DomainStartEndE-ValueType
Pfam:TSC22 1 60 1.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134109
Predicted Effect probably null
Transcript: ENSMUST00000140251
AA Change: K24*
SMART Domains Protein: ENSMUSP00000135806
Gene: ENSMUSG00000022010
AA Change: K24*

DomainStartEndE-ValueType
Pfam:TSC22 1 60 1.3e-35 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000142683
AA Change: K24*
SMART Domains Protein: ENSMUSP00000135493
Gene: ENSMUSG00000022010
AA Change: K24*

DomainStartEndE-ValueType
Pfam:TSC22 1 60 1.3e-35 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000177207
AA Change: K24*
SMART Domains Protein: ENSMUSP00000135296
Gene: ENSMUSG00000022010
AA Change: K24*

DomainStartEndE-ValueType
Pfam:TSC22 1 60 1.3e-35 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the TSC22 domain family of leucine zipper transcription factors. The encoded protein is stimulated by transforming growth factor beta, and regulates the transcription of multiple genes including C-type natriuretic peptide. The encoded protein may play a critical role in tumor suppression through the induction of cancer cell apoptosis, and a single nucleotide polymorphism in the promoter of this gene has been associated with diabetic nephropathy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mcie homozygous for a null allele exhibit increased proliferation of bone marrow cells and decreased kidney and heart weights. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,626,092 Y406* probably null Het
9530053A07Rik C T 7: 28,137,213 R186C probably damaging Het
Acadvl T C 11: 70,014,333 D109G probably benign Het
Adam24 G A 8: 40,681,503 G670E probably damaging Het
Angpt1 T C 15: 42,459,740 M378V probably benign Het
Ankrd33 G A 15: 101,117,112 probably null Het
Apol7b G A 15: 77,423,425 T290I probably benign Het
Atg4a-ps A G 3: 103,645,864 W54R probably damaging Het
B3glct A G 5: 149,739,604 probably null Het
Bmp7 A G 2: 172,872,913 S368P probably damaging Het
Boc A G 16: 44,491,791 V636A probably damaging Het
Cacna1i G A 15: 80,374,801 R1237H probably damaging Het
Cdcp1 T C 9: 123,173,915 D697G probably benign Het
Cep85l T C 10: 53,349,098 T132A probably benign Het
Ces1b T A 8: 93,060,410 Y447F probably damaging Het
Cntn4 A T 6: 106,697,583 T1015S probably benign Het
Eea1 T G 10: 96,002,879 probably null Het
Gm12800 G A 4: 101,910,094 C180Y possibly damaging Het
Gm4788 T G 1: 139,731,653 N642H possibly damaging Het
Hipk1 A T 3: 103,777,512 N262K possibly damaging Het
Jmjd8 G A 17: 25,829,052 R41H possibly damaging Het
Klhl3 T A 13: 58,030,445 T344S probably damaging Het
Krt39 T C 11: 99,519,821 D175G probably damaging Het
Map4k1 A G 7: 28,986,802 Y81C probably damaging Het
Mpdu1 T A 11: 69,658,585 T95S probably benign Het
Myl12b A T 17: 70,977,140 I31N probably damaging Het
Ndufaf5 T A 2: 140,188,780 Y195* probably null Het
Olfr1141 A G 2: 87,753,879 V38A probably benign Het
Olfr1224-ps1 G A 2: 89,156,813 R121C possibly damaging Het
Olfr617 T A 7: 103,584,520 I166N possibly damaging Het
Olfr621-ps1 A T 7: 103,629,583 F126I probably benign Het
Olfr984 T C 9: 40,101,356 I45V probably benign Het
Oxgr1 T A 14: 120,022,019 I259F possibly damaging Het
Pcdhb9 T A 18: 37,401,917 D321E probably benign Het
Pi4kb G T 3: 94,993,150 R392L probably damaging Het
Prss41 T C 17: 23,837,648 K151R probably benign Het
Rev3l T A 10: 39,821,481 V658D probably benign Het
Snx4 A G 16: 33,294,738 I430V probably damaging Het
Tanc2 C T 11: 105,835,230 H407Y possibly damaging Het
Tcf25 G A 8: 123,400,698 probably null Het
Vmn2r30 A G 7: 7,312,548 F762S probably damaging Het
Xrcc6 A G 15: 82,029,122 T319A probably benign Het
Zbtb1 C T 12: 76,386,211 R324* probably null Het
Zc3h7a A G 16: 11,145,671 Y729H probably damaging Het
Zfp329 C A 7: 12,806,530 probably benign Het
Zfp456 A T 13: 67,366,265 S441T probably benign Het
Other mutations in Tsc22d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Tsc22d1 APN 14 76418917 missense probably damaging 0.99
IGL00515:Tsc22d1 APN 14 76418477 missense probably damaging 0.99
IGL00703:Tsc22d1 APN 14 76504828 missense possibly damaging 0.62
IGL00974:Tsc22d1 APN 14 76506442 missense probably damaging 1.00
IGL01015:Tsc22d1 APN 14 76418741 missense possibly damaging 0.66
IGL01515:Tsc22d1 APN 14 76505299 critical splice donor site probably null
IGL02172:Tsc22d1 APN 14 76417692 missense probably benign 0.04
IGL02307:Tsc22d1 APN 14 76416461 missense probably damaging 0.99
IGL02553:Tsc22d1 APN 14 76417398 missense possibly damaging 0.73
IGL02870:Tsc22d1 APN 14 76417617 missense probably benign 0.42
IGL02989:Tsc22d1 APN 14 76418901 missense probably benign 0.05
IGL03216:Tsc22d1 APN 14 76418637 missense probably benign 0.02
R0127:Tsc22d1 UTSW 14 76418981 missense possibly damaging 0.92
R0416:Tsc22d1 UTSW 14 76505303 splice site probably benign
R0854:Tsc22d1 UTSW 14 76418201 nonsense probably null
R0963:Tsc22d1 UTSW 14 76418599 missense possibly damaging 0.92
R1370:Tsc22d1 UTSW 14 76437664 intron probably benign
R1736:Tsc22d1 UTSW 14 76418357 missense probably benign 0.08
R1751:Tsc22d1 UTSW 14 76418102 missense probably damaging 0.98
R1760:Tsc22d1 UTSW 14 76416948 missense possibly damaging 0.69
R1767:Tsc22d1 UTSW 14 76418102 missense probably damaging 0.98
R2020:Tsc22d1 UTSW 14 76418333 missense probably damaging 1.00
R2209:Tsc22d1 UTSW 14 76418740 missense probably damaging 1.00
R2439:Tsc22d1 UTSW 14 76417267 unclassified probably benign
R2471:Tsc22d1 UTSW 14 76418204 missense probably benign 0.00
R3114:Tsc22d1 UTSW 14 76417337 missense probably damaging 1.00
R3907:Tsc22d1 UTSW 14 76416543 missense probably damaging 0.98
R3973:Tsc22d1 UTSW 14 76418609 missense probably damaging 1.00
R3974:Tsc22d1 UTSW 14 76418609 missense probably damaging 1.00
R3975:Tsc22d1 UTSW 14 76418609 missense probably damaging 1.00
R3976:Tsc22d1 UTSW 14 76418609 missense probably damaging 1.00
R4292:Tsc22d1 UTSW 14 76418880 missense probably benign 0.12
R4612:Tsc22d1 UTSW 14 76419005 missense possibly damaging 0.66
R4806:Tsc22d1 UTSW 14 76416988 splice site probably null
R4980:Tsc22d1 UTSW 14 76418256 missense probably benign 0.02
R5068:Tsc22d1 UTSW 14 76418310 missense probably benign 0.44
R5070:Tsc22d1 UTSW 14 76418310 missense probably benign 0.44
R5239:Tsc22d1 UTSW 14 76418412 missense probably damaging 0.99
R5360:Tsc22d1 UTSW 14 76417267 unclassified probably benign
R5400:Tsc22d1 UTSW 14 76417054 missense probably benign 0.00
R5616:Tsc22d1 UTSW 14 76416217 unclassified probably benign
R5726:Tsc22d1 UTSW 14 76505317 nonsense probably null
R5934:Tsc22d1 UTSW 14 76418826 missense possibly damaging 0.87
R6860:Tsc22d1 UTSW 14 76418292 missense possibly damaging 0.73
R7016:Tsc22d1 UTSW 14 76417542 missense probably damaging 1.00
R7274:Tsc22d1 UTSW 14 76416714 missense probably damaging 0.98
R7482:Tsc22d1 UTSW 14 76418487 missense probably benign 0.10
R7532:Tsc22d1 UTSW 14 76416046 unclassified probably benign
R7536:Tsc22d1 UTSW 14 76504763 missense probably benign 0.00
R7784:Tsc22d1 UTSW 14 76416701 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTAAACTTGAGTATTGCGCGG -3'
(R):5'- TATGCGGTTGATCCTGAGC -3'

Sequencing Primer
(F):5'- ATGCGCAGATTTCCACAAGTGTG -3'
(R):5'- TGATCCTGAGCCCTGGGATG -3'
Posted On2018-11-06