Mutagenetix > Incidental Mutation

Incidental Mutation 'R6904:Tsc22d1'

538700

Institutional Source

Beutler Lab

Gene Symbol

Tsc22d1

Ensembl Gene

ENSMUSG00000022010

Gene Name

TSC22 domain family, member 1

Synonyms

TSC-22, Tgfb1i4, Egr5

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.266) question?

Stock #

R6904 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

76414961-76507765 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 76506483 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 24 (K24*)

Ref Sequence

ENSEMBL: ENSMUSP00000135296 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022587] [ENSMUST00000048371] [ENSMUST00000101618] [ENSMUST00000110888] [ENSMUST00000133224] [ENSMUST00000134109] [ENSMUST00000140251] [ENSMUST00000142683] [ENSMUST00000177207]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000022587
AA Change: K81*

SMART Domains

Protein: ENSMUSP00000022587
Gene: ENSMUSG00000022010
AA Change: K81*

Domain	Start	End	E-Value	Type
Pfam:TSC22	58	117	3.2e-35	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000048371
AA Change: K1015*

SMART Domains

Protein: ENSMUSP00000044517
Gene: ENSMUSG00000022010
AA Change: K1015*

Domain	Start	End	E-Value	Type
low complexity region	32	47	N/A	INTRINSIC
low complexity region	59	96	N/A	INTRINSIC
low complexity region	121	132	N/A	INTRINSIC
low complexity region	191	208	N/A	INTRINSIC
low complexity region	216	241	N/A	INTRINSIC
low complexity region	246	257	N/A	INTRINSIC
low complexity region	266	289	N/A	INTRINSIC
low complexity region	461	489	N/A	INTRINSIC
low complexity region	497	521	N/A	INTRINSIC
low complexity region	537	556	N/A	INTRINSIC
low complexity region	619	637	N/A	INTRINSIC
low complexity region	673	687	N/A	INTRINSIC
low complexity region	702	724	N/A	INTRINSIC
low complexity region	933	970	N/A	INTRINSIC
Pfam:TSC22	992	1048	7e-31	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000101618
AA Change: K45*

SMART Domains

Protein: ENSMUSP00000099140
Gene: ENSMUSG00000022010
AA Change: K45*

Domain	Start	End	E-Value	Type
Pfam:TSC22	22	81	1e-35	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000110888
AA Change: K933*

SMART Domains

Protein: ENSMUSP00000106513
Gene: ENSMUSG00000022010
AA Change: K933*

Domain	Start	End	E-Value	Type
low complexity region	32	47	N/A	INTRINSIC
low complexity region	59	96	N/A	INTRINSIC
low complexity region	121	132	N/A	INTRINSIC
low complexity region	191	208	N/A	INTRINSIC
low complexity region	216	241	N/A	INTRINSIC
low complexity region	246	257	N/A	INTRINSIC
low complexity region	266	289	N/A	INTRINSIC
low complexity region	379	407	N/A	INTRINSIC
low complexity region	415	439	N/A	INTRINSIC
low complexity region	455	474	N/A	INTRINSIC
internal_repeat_1	502	536	8.43e-5	PROSPERO
low complexity region	537	555	N/A	INTRINSIC
low complexity region	591	605	N/A	INTRINSIC
low complexity region	620	642	N/A	INTRINSIC
internal_repeat_1	644	676	8.43e-5	PROSPERO
low complexity region	851	888	N/A	INTRINSIC
Pfam:TSC22	910	969	4.7e-34	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000133224
AA Change: K24*

SMART Domains

Protein: ENSMUSP00000135561
Gene: ENSMUSG00000022010
AA Change: K24*

Domain	Start	End	E-Value	Type
Pfam:TSC22	1	60	1.3e-35	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000134109

Predicted Effect

probably null
Transcript: ENSMUST00000140251
AA Change: K24*

SMART Domains

Protein: ENSMUSP00000135806
Gene: ENSMUSG00000022010
AA Change: K24*

Domain	Start	End	E-Value	Type
Pfam:TSC22	1	60	1.3e-35	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000142683
AA Change: K24*

SMART Domains

Protein: ENSMUSP00000135493
Gene: ENSMUSG00000022010
AA Change: K24*

Domain	Start	End	E-Value	Type
Pfam:TSC22	1	60	1.3e-35	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000177207
AA Change: K24*

SMART Domains

Protein: ENSMUSP00000135296
Gene: ENSMUSG00000022010
AA Change: K24*

Domain	Start	End	E-Value	Type
Pfam:TSC22	1	60	1.3e-35	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the TSC22 domain family of leucine zipper transcription factors. The encoded protein is stimulated by transforming growth factor beta, and regulates the transcription of multiple genes including C-type natriuretic peptide. The encoded protein may play a critical role in tumor suppression through the induction of cancer cell apoptosis, and a single nucleotide polymorphism in the promoter of this gene has been associated with diabetic nephropathy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mcie homozygous for a null allele exhibit increased proliferation of bone marrow cells and decreased kidney and heart weights. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610021A01Rik	T	A	7: 41,626,092	Y406*	probably null	Het
9530053A07Rik	C	T	7: 28,137,213	R186C	probably damaging	Het
Acadvl	T	C	11: 70,014,333	D109G	probably benign	Het
Adam24	G	A	8: 40,681,503	G670E	probably damaging	Het
Angpt1	T	C	15: 42,459,740	M378V	probably benign	Het
Ankrd33	G	A	15: 101,117,112		probably null	Het
Apol7b	G	A	15: 77,423,425	T290I	probably benign	Het
Atg4a-ps	A	G	3: 103,645,864	W54R	probably damaging	Het
B3glct	A	G	5: 149,739,604		probably null	Het
Bmp7	A	G	2: 172,872,913	S368P	probably damaging	Het
Boc	A	G	16: 44,491,791	V636A	probably damaging	Het
Cacna1i	G	A	15: 80,374,801	R1237H	probably damaging	Het
Cdcp1	T	C	9: 123,173,915	D697G	probably benign	Het
Cep85l	T	C	10: 53,349,098	T132A	probably benign	Het
Ces1b	T	A	8: 93,060,410	Y447F	probably damaging	Het
Cntn4	A	T	6: 106,697,583	T1015S	probably benign	Het
Eea1	T	G	10: 96,002,879		probably null	Het
Gm12800	G	A	4: 101,910,094	C180Y	possibly damaging	Het
Gm4788	T	G	1: 139,731,653	N642H	possibly damaging	Het
Hipk1	A	T	3: 103,777,512	N262K	possibly damaging	Het
Jmjd8	G	A	17: 25,829,052	R41H	possibly damaging	Het
Klhl3	T	A	13: 58,030,445	T344S	probably damaging	Het
Krt39	T	C	11: 99,519,821	D175G	probably damaging	Het
Map4k1	A	G	7: 28,986,802	Y81C	probably damaging	Het
Mpdu1	T	A	11: 69,658,585	T95S	probably benign	Het
Myl12b	A	T	17: 70,977,140	I31N	probably damaging	Het
Ndufaf5	T	A	2: 140,188,780	Y195*	probably null	Het
Olfr1141	A	G	2: 87,753,879	V38A	probably benign	Het
Olfr1224-ps1	G	A	2: 89,156,813	R121C	possibly damaging	Het
Olfr617	T	A	7: 103,584,520	I166N	possibly damaging	Het
Olfr621-ps1	A	T	7: 103,629,583	F126I	probably benign	Het
Olfr984	T	C	9: 40,101,356	I45V	probably benign	Het
Oxgr1	T	A	14: 120,022,019	I259F	possibly damaging	Het
Pcdhb9	T	A	18: 37,401,917	D321E	probably benign	Het
Pi4kb	G	T	3: 94,993,150	R392L	probably damaging	Het
Prss41	T	C	17: 23,837,648	K151R	probably benign	Het
Rev3l	T	A	10: 39,821,481	V658D	probably benign	Het
Snx4	A	G	16: 33,294,738	I430V	probably damaging	Het
Tanc2	C	T	11: 105,835,230	H407Y	possibly damaging	Het
Tcf25	G	A	8: 123,400,698		probably null	Het
Vmn2r30	A	G	7: 7,312,548	F762S	probably damaging	Het
Xrcc6	A	G	15: 82,029,122	T319A	probably benign	Het
Zbtb1	C	T	12: 76,386,211	R324*	probably null	Het
Zc3h7a	A	G	16: 11,145,671	Y729H	probably damaging	Het
Zfp329	C	A	7: 12,806,530		probably benign	Het
Zfp456	A	T	13: 67,366,265	S441T	probably benign	Het

Other mutations in Tsc22d1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00499:Tsc22d1	APN	14	76418917	missense	probably damaging	0.99
IGL00515:Tsc22d1	APN	14	76418477	missense	probably damaging	0.99
IGL00703:Tsc22d1	APN	14	76504828	missense	possibly damaging	0.62
IGL00974:Tsc22d1	APN	14	76506442	missense	probably damaging	1.00
IGL01015:Tsc22d1	APN	14	76418741	missense	possibly damaging	0.66
IGL01515:Tsc22d1	APN	14	76505299	critical splice donor site	probably null
IGL02172:Tsc22d1	APN	14	76417692	missense	probably benign	0.04
IGL02307:Tsc22d1	APN	14	76416461	missense	probably damaging	0.99
IGL02553:Tsc22d1	APN	14	76417398	missense	possibly damaging	0.73
IGL02870:Tsc22d1	APN	14	76417617	missense	probably benign	0.42
IGL02989:Tsc22d1	APN	14	76418901	missense	probably benign	0.05
IGL03216:Tsc22d1	APN	14	76418637	missense	probably benign	0.02
R0127:Tsc22d1	UTSW	14	76418981	missense	possibly damaging	0.92
R0416:Tsc22d1	UTSW	14	76505303	splice site	probably benign
R0854:Tsc22d1	UTSW	14	76418201	nonsense	probably null
R0963:Tsc22d1	UTSW	14	76418599	missense	possibly damaging	0.92
R1370:Tsc22d1	UTSW	14	76437664	intron	probably benign
R1736:Tsc22d1	UTSW	14	76418357	missense	probably benign	0.08
R1751:Tsc22d1	UTSW	14	76418102	missense	probably damaging	0.98
R1760:Tsc22d1	UTSW	14	76416948	missense	possibly damaging	0.69
R1767:Tsc22d1	UTSW	14	76418102	missense	probably damaging	0.98
R2020:Tsc22d1	UTSW	14	76418333	missense	probably damaging	1.00
R2209:Tsc22d1	UTSW	14	76418740	missense	probably damaging	1.00
R2439:Tsc22d1	UTSW	14	76417267	unclassified	probably benign
R2471:Tsc22d1	UTSW	14	76418204	missense	probably benign	0.00
R3114:Tsc22d1	UTSW	14	76417337	missense	probably damaging	1.00
R3907:Tsc22d1	UTSW	14	76416543	missense	probably damaging	0.98
R3973:Tsc22d1	UTSW	14	76418609	missense	probably damaging	1.00
R3974:Tsc22d1	UTSW	14	76418609	missense	probably damaging	1.00
R3975:Tsc22d1	UTSW	14	76418609	missense	probably damaging	1.00
R3976:Tsc22d1	UTSW	14	76418609	missense	probably damaging	1.00
R4292:Tsc22d1	UTSW	14	76418880	missense	probably benign	0.12
R4612:Tsc22d1	UTSW	14	76419005	missense	possibly damaging	0.66
R4806:Tsc22d1	UTSW	14	76416988	splice site	probably null
R4980:Tsc22d1	UTSW	14	76418256	missense	probably benign	0.02
R5068:Tsc22d1	UTSW	14	76418310	missense	probably benign	0.44
R5070:Tsc22d1	UTSW	14	76418310	missense	probably benign	0.44
R5239:Tsc22d1	UTSW	14	76418412	missense	probably damaging	0.99
R5360:Tsc22d1	UTSW	14	76417267	unclassified	probably benign
R5400:Tsc22d1	UTSW	14	76417054	missense	probably benign	0.00
R5616:Tsc22d1	UTSW	14	76416217	unclassified	probably benign
R5726:Tsc22d1	UTSW	14	76505317	nonsense	probably null
R5934:Tsc22d1	UTSW	14	76418826	missense	possibly damaging	0.87
R6860:Tsc22d1	UTSW	14	76418292	missense	possibly damaging	0.73
R7016:Tsc22d1	UTSW	14	76417542	missense	probably damaging	1.00
R7274:Tsc22d1	UTSW	14	76416714	missense	probably damaging	0.98
R7482:Tsc22d1	UTSW	14	76418487	missense	probably benign	0.10
R7532:Tsc22d1	UTSW	14	76416046	unclassified	probably benign
R7536:Tsc22d1	UTSW	14	76504763	missense	probably benign	0.00
R7784:Tsc22d1	UTSW	14	76416701	nonsense	probably null
R8161:Tsc22d1	UTSW	14	76417020	missense	probably benign	0.02
R8405:Tsc22d1	UTSW	14	76418294	missense	probably damaging	1.00
R8963:Tsc22d1	UTSW	14	76418826	missense	probably benign	0.06
R9150:Tsc22d1	UTSW	14	76416616	missense	probably damaging	0.99
R9259:Tsc22d1	UTSW	14	76417044	missense	probably damaging	1.00
R9431:Tsc22d1	UTSW	14	76417267	unclassified	probably benign
R9439:Tsc22d1	UTSW	14	76506459	missense	probably damaging	0.99
R9614:Tsc22d1	UTSW	14	76416543	missense	probably damaging	0.98
R9708:Tsc22d1	UTSW	14	76417224	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- TTAAACTTGAGTATTGCGCGG -3'
(R):5'- TATGCGGTTGATCCTGAGC -3'

Sequencing Primer
(F):5'- ATGCGCAGATTTCCACAAGTGTG -3'
(R):5'- TGATCCTGAGCCCTGGGATG -3'

Posted On

2018-11-06