Incidental Mutation 'R6904:Tsc22d1'
ID 538700
Institutional Source Beutler Lab
Gene Symbol Tsc22d1
Ensembl Gene ENSMUSG00000022010
Gene Name TSC22 domain family, member 1
Synonyms Tgfb1i4, TSC-22, Egr5
MMRRC Submission 045033-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.268) question?
Stock # R6904 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 76652401-76745205 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 76743923 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 24 (K24*)
Ref Sequence ENSEMBL: ENSMUSP00000135296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022587] [ENSMUST00000048371] [ENSMUST00000101618] [ENSMUST00000110888] [ENSMUST00000133224] [ENSMUST00000134109] [ENSMUST00000140251] [ENSMUST00000142683] [ENSMUST00000177207]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000022587
AA Change: K81*
SMART Domains Protein: ENSMUSP00000022587
Gene: ENSMUSG00000022010
AA Change: K81*

DomainStartEndE-ValueType
Pfam:TSC22 58 117 3.2e-35 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000048371
AA Change: K1015*
SMART Domains Protein: ENSMUSP00000044517
Gene: ENSMUSG00000022010
AA Change: K1015*

DomainStartEndE-ValueType
low complexity region 32 47 N/A INTRINSIC
low complexity region 59 96 N/A INTRINSIC
low complexity region 121 132 N/A INTRINSIC
low complexity region 191 208 N/A INTRINSIC
low complexity region 216 241 N/A INTRINSIC
low complexity region 246 257 N/A INTRINSIC
low complexity region 266 289 N/A INTRINSIC
low complexity region 461 489 N/A INTRINSIC
low complexity region 497 521 N/A INTRINSIC
low complexity region 537 556 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
low complexity region 673 687 N/A INTRINSIC
low complexity region 702 724 N/A INTRINSIC
low complexity region 933 970 N/A INTRINSIC
Pfam:TSC22 992 1048 7e-31 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000101618
AA Change: K45*
SMART Domains Protein: ENSMUSP00000099140
Gene: ENSMUSG00000022010
AA Change: K45*

DomainStartEndE-ValueType
Pfam:TSC22 22 81 1e-35 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110888
AA Change: K933*
SMART Domains Protein: ENSMUSP00000106513
Gene: ENSMUSG00000022010
AA Change: K933*

DomainStartEndE-ValueType
low complexity region 32 47 N/A INTRINSIC
low complexity region 59 96 N/A INTRINSIC
low complexity region 121 132 N/A INTRINSIC
low complexity region 191 208 N/A INTRINSIC
low complexity region 216 241 N/A INTRINSIC
low complexity region 246 257 N/A INTRINSIC
low complexity region 266 289 N/A INTRINSIC
low complexity region 379 407 N/A INTRINSIC
low complexity region 415 439 N/A INTRINSIC
low complexity region 455 474 N/A INTRINSIC
internal_repeat_1 502 536 8.43e-5 PROSPERO
low complexity region 537 555 N/A INTRINSIC
low complexity region 591 605 N/A INTRINSIC
low complexity region 620 642 N/A INTRINSIC
internal_repeat_1 644 676 8.43e-5 PROSPERO
low complexity region 851 888 N/A INTRINSIC
Pfam:TSC22 910 969 4.7e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000133224
AA Change: K24*
SMART Domains Protein: ENSMUSP00000135561
Gene: ENSMUSG00000022010
AA Change: K24*

DomainStartEndE-ValueType
Pfam:TSC22 1 60 1.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134109
Predicted Effect probably null
Transcript: ENSMUST00000140251
AA Change: K24*
SMART Domains Protein: ENSMUSP00000135806
Gene: ENSMUSG00000022010
AA Change: K24*

DomainStartEndE-ValueType
Pfam:TSC22 1 60 1.3e-35 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000142683
AA Change: K24*
SMART Domains Protein: ENSMUSP00000135493
Gene: ENSMUSG00000022010
AA Change: K24*

DomainStartEndE-ValueType
Pfam:TSC22 1 60 1.3e-35 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000177207
AA Change: K24*
SMART Domains Protein: ENSMUSP00000135296
Gene: ENSMUSG00000022010
AA Change: K24*

DomainStartEndE-ValueType
Pfam:TSC22 1 60 1.3e-35 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the TSC22 domain family of leucine zipper transcription factors. The encoded protein is stimulated by transforming growth factor beta, and regulates the transcription of multiple genes including C-type natriuretic peptide. The encoded protein may play a critical role in tumor suppression through the induction of cancer cell apoptosis, and a single nucleotide polymorphism in the promoter of this gene has been associated with diabetic nephropathy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mcie homozygous for a null allele exhibit increased proliferation of bone marrow cells and decreased kidney and heart weights. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,275,516 (GRCm39) Y406* probably null Het
Acadvl T C 11: 69,905,159 (GRCm39) D109G probably benign Het
Adam24 G A 8: 41,134,542 (GRCm39) G670E probably damaging Het
Angpt1 T C 15: 42,323,136 (GRCm39) M378V probably benign Het
Ankrd33 G A 15: 101,014,993 (GRCm39) probably null Het
Apol7b G A 15: 77,307,625 (GRCm39) T290I probably benign Het
Atg4a-ps A G 3: 103,553,180 (GRCm39) W54R probably damaging Het
B3glct A G 5: 149,663,069 (GRCm39) probably null Het
Bmp7 A G 2: 172,714,706 (GRCm39) S368P probably damaging Het
Boc A G 16: 44,312,154 (GRCm39) V636A probably damaging Het
Cacna1i G A 15: 80,259,002 (GRCm39) R1237H probably damaging Het
Cdcp1 T C 9: 123,002,980 (GRCm39) D697G probably benign Het
Cep85l T C 10: 53,225,194 (GRCm39) T132A probably benign Het
Ces1b T A 8: 93,787,038 (GRCm39) Y447F probably damaging Het
Cfhr4 T G 1: 139,659,391 (GRCm39) N642H possibly damaging Het
Cntn4 A T 6: 106,674,544 (GRCm39) T1015S probably benign Het
Eea1 T G 10: 95,838,741 (GRCm39) probably null Het
Fcgbpl1 C T 7: 27,836,638 (GRCm39) R186C probably damaging Het
Hipk1 A T 3: 103,684,828 (GRCm39) N262K possibly damaging Het
Jmjd8 G A 17: 26,048,026 (GRCm39) R41H possibly damaging Het
Klhl3 T A 13: 58,178,259 (GRCm39) T344S probably damaging Het
Krt39 T C 11: 99,410,647 (GRCm39) D175G probably damaging Het
Map4k1 A G 7: 28,686,227 (GRCm39) Y81C probably damaging Het
Mpdu1 T A 11: 69,549,411 (GRCm39) T95S probably benign Het
Myl12b A T 17: 71,284,135 (GRCm39) I31N probably damaging Het
Ndufaf5 T A 2: 140,030,700 (GRCm39) Y195* probably null Het
Or4c119 G A 2: 88,987,157 (GRCm39) R121C possibly damaging Het
Or4d5 T C 9: 40,012,652 (GRCm39) I45V probably benign Het
Or51v15-ps1 A T 7: 103,278,790 (GRCm39) F126I probably benign Het
Or52z12 T A 7: 103,233,727 (GRCm39) I166N possibly damaging Het
Or5w17 A G 2: 87,584,223 (GRCm39) V38A probably benign Het
Oxgr1 T A 14: 120,259,431 (GRCm39) I259F possibly damaging Het
Pcdhb9 T A 18: 37,534,970 (GRCm39) D321E probably benign Het
Pi4kb G T 3: 94,900,461 (GRCm39) R392L probably damaging Het
Pramel18 G A 4: 101,767,291 (GRCm39) C180Y possibly damaging Het
Prss41 T C 17: 24,056,622 (GRCm39) K151R probably benign Het
Rev3l T A 10: 39,697,477 (GRCm39) V658D probably benign Het
Snx4 A G 16: 33,115,108 (GRCm39) I430V probably damaging Het
Tanc2 C T 11: 105,726,056 (GRCm39) H407Y possibly damaging Het
Tcf25 G A 8: 124,127,437 (GRCm39) probably null Het
Vmn2r30 A G 7: 7,315,547 (GRCm39) F762S probably damaging Het
Xrcc6 A G 15: 81,913,323 (GRCm39) T319A probably benign Het
Zbtb1 C T 12: 76,432,985 (GRCm39) R324* probably null Het
Zc3h7a A G 16: 10,963,535 (GRCm39) Y729H probably damaging Het
Zfp329 C A 7: 12,540,457 (GRCm39) probably benign Het
Zfp456 A T 13: 67,514,384 (GRCm39) S441T probably benign Het
Other mutations in Tsc22d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Tsc22d1 APN 14 76,656,357 (GRCm39) missense probably damaging 0.99
IGL00515:Tsc22d1 APN 14 76,655,917 (GRCm39) missense probably damaging 0.99
IGL00703:Tsc22d1 APN 14 76,742,268 (GRCm39) missense possibly damaging 0.62
IGL00974:Tsc22d1 APN 14 76,743,882 (GRCm39) missense probably damaging 1.00
IGL01015:Tsc22d1 APN 14 76,656,181 (GRCm39) missense possibly damaging 0.66
IGL01515:Tsc22d1 APN 14 76,742,739 (GRCm39) critical splice donor site probably null
IGL02172:Tsc22d1 APN 14 76,655,132 (GRCm39) missense probably benign 0.04
IGL02307:Tsc22d1 APN 14 76,653,901 (GRCm39) missense probably damaging 0.99
IGL02553:Tsc22d1 APN 14 76,654,838 (GRCm39) missense possibly damaging 0.73
IGL02870:Tsc22d1 APN 14 76,655,057 (GRCm39) missense probably benign 0.42
IGL02989:Tsc22d1 APN 14 76,656,341 (GRCm39) missense probably benign 0.05
IGL03216:Tsc22d1 APN 14 76,656,077 (GRCm39) missense probably benign 0.02
R0127:Tsc22d1 UTSW 14 76,656,421 (GRCm39) missense possibly damaging 0.92
R0416:Tsc22d1 UTSW 14 76,742,743 (GRCm39) splice site probably benign
R0854:Tsc22d1 UTSW 14 76,655,641 (GRCm39) nonsense probably null
R0963:Tsc22d1 UTSW 14 76,656,039 (GRCm39) missense possibly damaging 0.92
R1370:Tsc22d1 UTSW 14 76,675,104 (GRCm39) intron probably benign
R1736:Tsc22d1 UTSW 14 76,655,797 (GRCm39) missense probably benign 0.08
R1751:Tsc22d1 UTSW 14 76,655,542 (GRCm39) missense probably damaging 0.98
R1760:Tsc22d1 UTSW 14 76,654,388 (GRCm39) missense possibly damaging 0.69
R1767:Tsc22d1 UTSW 14 76,655,542 (GRCm39) missense probably damaging 0.98
R2020:Tsc22d1 UTSW 14 76,655,773 (GRCm39) missense probably damaging 1.00
R2209:Tsc22d1 UTSW 14 76,656,180 (GRCm39) missense probably damaging 1.00
R2439:Tsc22d1 UTSW 14 76,654,707 (GRCm39) unclassified probably benign
R2471:Tsc22d1 UTSW 14 76,655,644 (GRCm39) missense probably benign 0.00
R3114:Tsc22d1 UTSW 14 76,654,777 (GRCm39) missense probably damaging 1.00
R3907:Tsc22d1 UTSW 14 76,653,983 (GRCm39) missense probably damaging 0.98
R3973:Tsc22d1 UTSW 14 76,656,049 (GRCm39) missense probably damaging 1.00
R3974:Tsc22d1 UTSW 14 76,656,049 (GRCm39) missense probably damaging 1.00
R3975:Tsc22d1 UTSW 14 76,656,049 (GRCm39) missense probably damaging 1.00
R3976:Tsc22d1 UTSW 14 76,656,049 (GRCm39) missense probably damaging 1.00
R4292:Tsc22d1 UTSW 14 76,656,320 (GRCm39) missense probably benign 0.12
R4612:Tsc22d1 UTSW 14 76,656,445 (GRCm39) missense possibly damaging 0.66
R4806:Tsc22d1 UTSW 14 76,654,428 (GRCm39) splice site probably null
R4980:Tsc22d1 UTSW 14 76,655,696 (GRCm39) missense probably benign 0.02
R5068:Tsc22d1 UTSW 14 76,655,750 (GRCm39) missense probably benign 0.44
R5070:Tsc22d1 UTSW 14 76,655,750 (GRCm39) missense probably benign 0.44
R5239:Tsc22d1 UTSW 14 76,655,852 (GRCm39) missense probably damaging 0.99
R5360:Tsc22d1 UTSW 14 76,654,707 (GRCm39) unclassified probably benign
R5400:Tsc22d1 UTSW 14 76,654,494 (GRCm39) missense probably benign 0.00
R5616:Tsc22d1 UTSW 14 76,653,657 (GRCm39) unclassified probably benign
R5726:Tsc22d1 UTSW 14 76,742,757 (GRCm39) nonsense probably null
R5934:Tsc22d1 UTSW 14 76,656,266 (GRCm39) missense possibly damaging 0.87
R6860:Tsc22d1 UTSW 14 76,655,732 (GRCm39) missense possibly damaging 0.73
R7016:Tsc22d1 UTSW 14 76,654,982 (GRCm39) missense probably damaging 1.00
R7274:Tsc22d1 UTSW 14 76,654,154 (GRCm39) missense probably damaging 0.98
R7482:Tsc22d1 UTSW 14 76,655,927 (GRCm39) missense probably benign 0.10
R7532:Tsc22d1 UTSW 14 76,653,486 (GRCm39) unclassified probably benign
R7536:Tsc22d1 UTSW 14 76,742,203 (GRCm39) missense probably benign 0.00
R7784:Tsc22d1 UTSW 14 76,654,141 (GRCm39) nonsense probably null
R8161:Tsc22d1 UTSW 14 76,654,460 (GRCm39) missense probably benign 0.02
R8405:Tsc22d1 UTSW 14 76,655,734 (GRCm39) missense probably damaging 1.00
R8963:Tsc22d1 UTSW 14 76,656,266 (GRCm39) missense probably benign 0.06
R9150:Tsc22d1 UTSW 14 76,654,056 (GRCm39) missense probably damaging 0.99
R9259:Tsc22d1 UTSW 14 76,654,484 (GRCm39) missense probably damaging 1.00
R9431:Tsc22d1 UTSW 14 76,654,707 (GRCm39) unclassified probably benign
R9439:Tsc22d1 UTSW 14 76,743,899 (GRCm39) missense probably damaging 0.99
R9614:Tsc22d1 UTSW 14 76,653,983 (GRCm39) missense probably damaging 0.98
R9708:Tsc22d1 UTSW 14 76,654,664 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TTAAACTTGAGTATTGCGCGG -3'
(R):5'- TATGCGGTTGATCCTGAGC -3'

Sequencing Primer
(F):5'- ATGCGCAGATTTCCACAAGTGTG -3'
(R):5'- TGATCCTGAGCCCTGGGATG -3'
Posted On 2018-11-06