Incidental Mutation 'R6904:Angpt1'
ID538702
Institutional Source Beutler Lab
Gene Symbol Angpt1
Ensembl Gene ENSMUSG00000022309
Gene Nameangiopoietin 1
SynonymsAngiopoietin-1, 1110046O21Rik, Ang-1, ang1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6904 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location42424723-42676977 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42459740 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 378 (M378V)
Ref Sequence ENSEMBL: ENSMUSP00000022921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022921]
Predicted Effect probably benign
Transcript: ENSMUST00000022921
AA Change: M378V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000022921
Gene: ENSMUSG00000022309
AA Change: M378V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
coiled coil region 194 254 N/A INTRINSIC
FBG 281 496 3.04e-132 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted glycoprotein that belongs to the angiopoietin family of vascular growth factors. The encoded protein is a ligand in the vascular tyrosine kinase signaling pathway and regulates the formation and stabilization of blood vessels. This protein also functions in striated muscles by promoting proliferation, migration and differentiation of skeletal myoblasts and plays an essential role in the vascular response to tissue injury. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality by E12.5 and deficits in vascular development such as a reduction in vascular branching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,626,092 Y406* probably null Het
9530053A07Rik C T 7: 28,137,213 R186C probably damaging Het
Acadvl T C 11: 70,014,333 D109G probably benign Het
Adam24 G A 8: 40,681,503 G670E probably damaging Het
Ankrd33 G A 15: 101,117,112 probably null Het
Apol7b G A 15: 77,423,425 T290I probably benign Het
Atg4a-ps A G 3: 103,645,864 W54R probably damaging Het
B3glct A G 5: 149,739,604 probably null Het
Bmp7 A G 2: 172,872,913 S368P probably damaging Het
Boc A G 16: 44,491,791 V636A probably damaging Het
Cacna1i G A 15: 80,374,801 R1237H probably damaging Het
Cdcp1 T C 9: 123,173,915 D697G probably benign Het
Cep85l T C 10: 53,349,098 T132A probably benign Het
Ces1b T A 8: 93,060,410 Y447F probably damaging Het
Cntn4 A T 6: 106,697,583 T1015S probably benign Het
Eea1 T G 10: 96,002,879 probably null Het
Gm12800 G A 4: 101,910,094 C180Y possibly damaging Het
Gm4788 T G 1: 139,731,653 N642H possibly damaging Het
Hipk1 A T 3: 103,777,512 N262K possibly damaging Het
Jmjd8 G A 17: 25,829,052 R41H possibly damaging Het
Klhl3 T A 13: 58,030,445 T344S probably damaging Het
Krt39 T C 11: 99,519,821 D175G probably damaging Het
Map4k1 A G 7: 28,986,802 Y81C probably damaging Het
Mpdu1 T A 11: 69,658,585 T95S probably benign Het
Myl12b A T 17: 70,977,140 I31N probably damaging Het
Ndufaf5 T A 2: 140,188,780 Y195* probably null Het
Olfr1141 A G 2: 87,753,879 V38A probably benign Het
Olfr1224-ps1 G A 2: 89,156,813 R121C possibly damaging Het
Olfr617 T A 7: 103,584,520 I166N possibly damaging Het
Olfr621-ps1 A T 7: 103,629,583 F126I probably benign Het
Olfr984 T C 9: 40,101,356 I45V probably benign Het
Oxgr1 T A 14: 120,022,019 I259F possibly damaging Het
Pcdhb9 T A 18: 37,401,917 D321E probably benign Het
Pi4kb G T 3: 94,993,150 R392L probably damaging Het
Prss41 T C 17: 23,837,648 K151R probably benign Het
Rev3l T A 10: 39,821,481 V658D probably benign Het
Snx4 A G 16: 33,294,738 I430V probably damaging Het
Tanc2 C T 11: 105,835,230 H407Y possibly damaging Het
Tcf25 G A 8: 123,400,698 probably null Het
Tsc22d1 A T 14: 76,506,483 K24* probably null Het
Vmn2r30 A G 7: 7,312,548 F762S probably damaging Het
Xrcc6 A G 15: 82,029,122 T319A probably benign Het
Zbtb1 C T 12: 76,386,211 R324* probably null Het
Zc3h7a A G 16: 11,145,671 Y729H probably damaging Het
Zfp329 C A 7: 12,806,530 probably benign Het
Zfp456 A T 13: 67,366,265 S441T probably benign Het
Other mutations in Angpt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Angpt1 APN 15 42476467 missense possibly damaging 0.73
IGL02671:Angpt1 APN 15 42676394 missense possibly damaging 0.79
IGL02876:Angpt1 APN 15 42426977 missense possibly damaging 0.68
IGL03077:Angpt1 APN 15 42476422 nonsense probably null
IGL03334:Angpt1 APN 15 42496412 missense possibly damaging 0.94
R0226:Angpt1 UTSW 15 42468235 missense probably benign 0.01
R1774:Angpt1 UTSW 15 42523616 missense probably damaging 0.99
R1800:Angpt1 UTSW 15 42512404 missense probably damaging 0.96
R1967:Angpt1 UTSW 15 42438307 missense probably damaging 1.00
R4093:Angpt1 UTSW 15 42523545 missense probably damaging 1.00
R4477:Angpt1 UTSW 15 42468164 missense probably damaging 1.00
R4629:Angpt1 UTSW 15 42438400 missense probably benign 0.01
R4647:Angpt1 UTSW 15 42676184 missense probably benign 0.02
R4648:Angpt1 UTSW 15 42676184 missense probably benign 0.02
R4750:Angpt1 UTSW 15 42676401 missense probably benign 0.00
R5222:Angpt1 UTSW 15 42676334 missense probably damaging 1.00
R5386:Angpt1 UTSW 15 42438365 missense probably damaging 1.00
R5457:Angpt1 UTSW 15 42523520 missense probably damaging 1.00
R5526:Angpt1 UTSW 15 42512341 missense probably damaging 1.00
R6154:Angpt1 UTSW 15 42523655 missense probably damaging 1.00
R7009:Angpt1 UTSW 15 42523595 missense possibly damaging 0.83
R7101:Angpt1 UTSW 15 42523569 missense probably benign 0.18
R7139:Angpt1 UTSW 15 42676351 missense probably damaging 1.00
R7234:Angpt1 UTSW 15 42459725 missense probably benign 0.25
R7830:Angpt1 UTSW 15 42676268 missense probably damaging 1.00
R8046:Angpt1 UTSW 15 42496356 missense probably benign 0.00
R8073:Angpt1 UTSW 15 42438303 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACGGAAACCTTGACTGTCCA -3'
(R):5'- CCAAGAATGTCACAGTAAACAGAGT -3'

Sequencing Primer
(F):5'- TCCAGTGAAGAGGATCATCTGCATC -3'
(R):5'- AGTGTAAAATGCAAGCAAAACTATG -3'
Posted On2018-11-06