Incidental Mutation 'R6904:Xrcc6'
ID538705
Institutional Source Beutler Lab
Gene Symbol Xrcc6
Ensembl Gene ENSMUSG00000022471
Gene NameX-ray repair complementing defective repair in Chinese hamster cells 6
SynonymsKu p70, G22p1, Ku70
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6904 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location81987835-82040085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82029122 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 319 (T319A)
Ref Sequence ENSEMBL: ENSMUSP00000097968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069530] [ENSMUST00000100399] [ENSMUST00000164779] [ENSMUST00000230729]
Predicted Effect probably benign
Transcript: ENSMUST00000069530
AA Change: T319A

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000068559
Gene: ENSMUSG00000022471
AA Change: T319A

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
VWA 32 246 1.79e0 SMART
Ku78 306 452 2.91e-56 SMART
Pfam:Ku_C 467 557 5e-34 PFAM
SAP 571 605 2.38e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100399
AA Change: T319A

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000097968
Gene: ENSMUSG00000022471
AA Change: T319A

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
VWA 32 246 1.79e0 SMART
Ku78 306 452 2.91e-56 SMART
Pfam:Ku_C 470 555 3.1e-31 PFAM
SAP 571 605 2.38e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164779
SMART Domains Protein: ENSMUSP00000127927
Gene: ENSMUSG00000022471

DomainStartEndE-ValueType
Pfam:Ku_N 1 96 4.6e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000230729
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The p70/p80 autoantigen is a nuclear complex consisting of two subunits with molecular masses of approximately 70 and 80 kDa. The complex functions as a single-stranded DNA-dependent ATP-dependent helicase. The complex may be involved in the repair of nonhomologous DNA ends such as that required for double-strand break repair, transposition, and V(D)J recombination. High levels of autoantibodies to p70 and p80 have been found in some patients with systemic lupus erythematosus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neuron apoptosis, decreased body size, abnormal B and T cell morphology, increased incidence of tumorigenesis, and increased cellular sensitivity to irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,626,092 Y406* probably null Het
9530053A07Rik C T 7: 28,137,213 R186C probably damaging Het
Acadvl T C 11: 70,014,333 D109G probably benign Het
Adam24 G A 8: 40,681,503 G670E probably damaging Het
Angpt1 T C 15: 42,459,740 M378V probably benign Het
Ankrd33 G A 15: 101,117,112 probably null Het
Apol7b G A 15: 77,423,425 T290I probably benign Het
Atg4a-ps A G 3: 103,645,864 W54R probably damaging Het
B3glct A G 5: 149,739,604 probably null Het
Bmp7 A G 2: 172,872,913 S368P probably damaging Het
Boc A G 16: 44,491,791 V636A probably damaging Het
Cacna1i G A 15: 80,374,801 R1237H probably damaging Het
Cdcp1 T C 9: 123,173,915 D697G probably benign Het
Cep85l T C 10: 53,349,098 T132A probably benign Het
Ces1b T A 8: 93,060,410 Y447F probably damaging Het
Cntn4 A T 6: 106,697,583 T1015S probably benign Het
Eea1 T G 10: 96,002,879 probably null Het
Gm12800 G A 4: 101,910,094 C180Y possibly damaging Het
Gm4788 T G 1: 139,731,653 N642H possibly damaging Het
Hipk1 A T 3: 103,777,512 N262K possibly damaging Het
Jmjd8 G A 17: 25,829,052 R41H possibly damaging Het
Klhl3 T A 13: 58,030,445 T344S probably damaging Het
Krt39 T C 11: 99,519,821 D175G probably damaging Het
Map4k1 A G 7: 28,986,802 Y81C probably damaging Het
Mpdu1 T A 11: 69,658,585 T95S probably benign Het
Myl12b A T 17: 70,977,140 I31N probably damaging Het
Ndufaf5 T A 2: 140,188,780 Y195* probably null Het
Olfr1141 A G 2: 87,753,879 V38A probably benign Het
Olfr1224-ps1 G A 2: 89,156,813 R121C possibly damaging Het
Olfr617 T A 7: 103,584,520 I166N possibly damaging Het
Olfr621-ps1 A T 7: 103,629,583 F126I probably benign Het
Olfr984 T C 9: 40,101,356 I45V probably benign Het
Oxgr1 T A 14: 120,022,019 I259F possibly damaging Het
Pcdhb9 T A 18: 37,401,917 D321E probably benign Het
Pi4kb G T 3: 94,993,150 R392L probably damaging Het
Prss41 T C 17: 23,837,648 K151R probably benign Het
Rev3l T A 10: 39,821,481 V658D probably benign Het
Snx4 A G 16: 33,294,738 I430V probably damaging Het
Tanc2 C T 11: 105,835,230 H407Y possibly damaging Het
Tcf25 G A 8: 123,400,698 probably null Het
Tsc22d1 A T 14: 76,506,483 K24* probably null Het
Vmn2r30 A G 7: 7,312,548 F762S probably damaging Het
Zbtb1 C T 12: 76,386,211 R324* probably null Het
Zc3h7a A G 16: 11,145,671 Y729H probably damaging Het
Zfp329 C A 7: 12,806,530 probably benign Het
Zfp456 A T 13: 67,366,265 S441T probably benign Het
Other mutations in Xrcc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00701:Xrcc6 APN 15 82017200 critical splice donor site probably null
IGL01394:Xrcc6 APN 15 82025661 missense possibly damaging 0.69
IGL01648:Xrcc6 APN 15 82025634 missense probably damaging 0.96
R0312:Xrcc6 UTSW 15 82027222 splice site probably null
R0522:Xrcc6 UTSW 15 82022592 splice site probably benign
R1172:Xrcc6 UTSW 15 82031163 missense probably damaging 1.00
R1173:Xrcc6 UTSW 15 82031163 missense probably damaging 1.00
R1218:Xrcc6 UTSW 15 82022941 missense probably benign 0.00
R1269:Xrcc6 UTSW 15 82022847 missense possibly damaging 0.49
R1677:Xrcc6 UTSW 15 82029699 missense probably benign
R2049:Xrcc6 UTSW 15 82022977 missense probably damaging 1.00
R2140:Xrcc6 UTSW 15 82022977 missense probably damaging 1.00
R2142:Xrcc6 UTSW 15 82022977 missense probably damaging 1.00
R3737:Xrcc6 UTSW 15 82029631 missense probably damaging 1.00
R3870:Xrcc6 UTSW 15 82025684 missense probably benign 0.16
R3906:Xrcc6 UTSW 15 82029571 missense probably benign 0.01
R4197:Xrcc6 UTSW 15 82029224 missense probably benign 0.06
R4589:Xrcc6 UTSW 15 82022460 missense probably damaging 1.00
R4941:Xrcc6 UTSW 15 82039812 missense probably damaging 1.00
R5318:Xrcc6 UTSW 15 82037507 missense probably damaging 1.00
R5356:Xrcc6 UTSW 15 82029218 missense probably benign 0.00
R5576:Xrcc6 UTSW 15 82022492 missense probably damaging 1.00
R6157:Xrcc6 UTSW 15 82029104 intron probably null
R6596:Xrcc6 UTSW 15 82022954 start codon destroyed probably null 0.58
R6970:Xrcc6 UTSW 15 82031174 missense probably benign 0.03
R7098:Xrcc6 UTSW 15 82035754 nonsense probably null
R7213:Xrcc6 UTSW 15 82016826 intron probably benign
R7642:Xrcc6 UTSW 15 82016477 critical splice donor site probably null
R7845:Xrcc6 UTSW 15 82016477 critical splice donor site probably null
R7928:Xrcc6 UTSW 15 82016477 critical splice donor site probably null
X0063:Xrcc6 UTSW 15 82022493 missense possibly damaging 0.92
Z1176:Xrcc6 UTSW 15 82029213 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCACTATGTGTGCTATCCAC -3'
(R):5'- TTTCCCAGGGATCTGAGCAG -3'

Sequencing Primer
(F):5'- CATCGGAATTGTGGGCACATC -3'
(R):5'- ATCTGAGCAGGGAGTCTCG -3'
Posted On2018-11-06