Incidental Mutation 'R6904:Prss41'
ID538710
Institutional Source Beutler Lab
Gene Symbol Prss41
Ensembl Gene ENSMUSG00000024114
Gene Nameprotease, serine 41
Synonyms4931440B09Rik, Tessp1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R6904 (G1)
Quality Score89.0077
Status Not validated
Chromosome17
Chromosomal Location23836785-23844172 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23837648 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 151 (K151R)
Ref Sequence ENSEMBL: ENSMUSP00000120141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024926] [ENSMUST00000059906] [ENSMUST00000115444] [ENSMUST00000122936] [ENSMUST00000151797]
Predicted Effect probably benign
Transcript: ENSMUST00000024926
AA Change: K191R

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000024926
Gene: ENSMUSG00000024114
AA Change: K191R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 52 289 2.48e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000059906
SMART Domains Protein: ENSMUSP00000059491
Gene: ENSMUSG00000049620

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Tryp_SPc 33 271 9.03e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115444
SMART Domains Protein: ENSMUSP00000111104
Gene: ENSMUSG00000049620

DomainStartEndE-ValueType
Tryp_SPc 15 253 4.5e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122936
AA Change: K151R

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000120141
Gene: ENSMUSG00000024114
AA Change: K151R

DomainStartEndE-ValueType
Tryp_SPc 12 249 2.48e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151797
SMART Domains Protein: ENSMUSP00000122453
Gene: ENSMUSG00000024114

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 52 204 2.91e-12 SMART
low complexity region 228 244 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,626,092 Y406* probably null Het
9530053A07Rik C T 7: 28,137,213 R186C probably damaging Het
Acadvl T C 11: 70,014,333 D109G probably benign Het
Adam24 G A 8: 40,681,503 G670E probably damaging Het
Angpt1 T C 15: 42,459,740 M378V probably benign Het
Ankrd33 G A 15: 101,117,112 probably null Het
Apol7b G A 15: 77,423,425 T290I probably benign Het
Atg4a-ps A G 3: 103,645,864 W54R probably damaging Het
B3glct A G 5: 149,739,604 probably null Het
Bmp7 A G 2: 172,872,913 S368P probably damaging Het
Boc A G 16: 44,491,791 V636A probably damaging Het
Cacna1i G A 15: 80,374,801 R1237H probably damaging Het
Cdcp1 T C 9: 123,173,915 D697G probably benign Het
Cep85l T C 10: 53,349,098 T132A probably benign Het
Ces1b T A 8: 93,060,410 Y447F probably damaging Het
Cntn4 A T 6: 106,697,583 T1015S probably benign Het
Eea1 T G 10: 96,002,879 probably null Het
Gm12800 G A 4: 101,910,094 C180Y possibly damaging Het
Gm4788 T G 1: 139,731,653 N642H possibly damaging Het
Hipk1 A T 3: 103,777,512 N262K possibly damaging Het
Jmjd8 G A 17: 25,829,052 R41H possibly damaging Het
Klhl3 T A 13: 58,030,445 T344S probably damaging Het
Krt39 T C 11: 99,519,821 D175G probably damaging Het
Map4k1 A G 7: 28,986,802 Y81C probably damaging Het
Mpdu1 T A 11: 69,658,585 T95S probably benign Het
Myl12b A T 17: 70,977,140 I31N probably damaging Het
Ndufaf5 T A 2: 140,188,780 Y195* probably null Het
Olfr1141 A G 2: 87,753,879 V38A probably benign Het
Olfr1224-ps1 G A 2: 89,156,813 R121C possibly damaging Het
Olfr617 T A 7: 103,584,520 I166N possibly damaging Het
Olfr621-ps1 A T 7: 103,629,583 F126I probably benign Het
Olfr984 T C 9: 40,101,356 I45V probably benign Het
Oxgr1 T A 14: 120,022,019 I259F possibly damaging Het
Pcdhb9 T A 18: 37,401,917 D321E probably benign Het
Pi4kb G T 3: 94,993,150 R392L probably damaging Het
Rev3l T A 10: 39,821,481 V658D probably benign Het
Snx4 A G 16: 33,294,738 I430V probably damaging Het
Tanc2 C T 11: 105,835,230 H407Y possibly damaging Het
Tcf25 G A 8: 123,400,698 probably null Het
Tsc22d1 A T 14: 76,506,483 K24* probably null Het
Vmn2r30 A G 7: 7,312,548 F762S probably damaging Het
Xrcc6 A G 15: 82,029,122 T319A probably benign Het
Zbtb1 C T 12: 76,386,211 R324* probably null Het
Zc3h7a A G 16: 11,145,671 Y729H probably damaging Het
Zfp329 C A 7: 12,806,530 probably benign Het
Zfp456 A T 13: 67,366,265 S441T probably benign Het
Other mutations in Prss41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02215:Prss41 APN 17 23843856 missense probably benign 0.01
IGL03031:Prss41 APN 17 23842422 missense probably damaging 1.00
IGL03131:Prss41 APN 17 23842524 missense probably benign 0.00
FR4737:Prss41 UTSW 17 23844097 small deletion probably benign
R0491:Prss41 UTSW 17 23842503 missense possibly damaging 0.91
R2014:Prss41 UTSW 17 23837490 critical splice donor site probably null
R3813:Prss41 UTSW 17 23837622 nonsense probably null
R4888:Prss41 UTSW 17 23837003 missense probably benign 0.08
R5707:Prss41 UTSW 17 23842416 missense probably benign 0.00
R7486:Prss41 UTSW 17 23844098 small deletion probably benign
R7782:Prss41 UTSW 17 23837113 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TCTCCAGCCTGAAGTGAAGGAG -3'
(R):5'- CTCTTGCCCTTAAGAGTAGAGG -3'

Sequencing Primer
(F):5'- TTCCTCAGAGGGGCAGG -3'
(R):5'- CTTGCCCTTAAGAGTAGAGGAGGTC -3'
Posted On2018-11-06