Incidental Mutation 'R6904:Myl12b'
ID538712
Institutional Source Beutler Lab
Gene Symbol Myl12b
Ensembl Gene ENSMUSG00000034868
Gene Namemyosin, light chain 12B, regulatory
SynonymsMylc2b, RLC-B, 1500001M02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock #R6904 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location70973920-70990787 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70977140 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 31 (I31N)
Ref Sequence ENSEMBL: ENSMUSP00000042364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038446]
Predicted Effect probably damaging
Transcript: ENSMUST00000038446
AA Change: I31N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042364
Gene: ENSMUSG00000034868
AA Change: I31N

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
EFh 33 61 1.26e-7 SMART
EFh 102 130 1.25e0 SMART
Blast:EFh 138 166 6e-12 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nonsarcomeric myosin regulatory light chain. This protein is activated by phosphorylation and regulates smooth muscle and non-muscle cell contraction. This protein may also be involved in DNA damage repair by sequestering the transcriptional regulator apoptosis-antagonizing transcription factor (AATF)/Che-1 which functions as a repressor of p53-driven apoptosis. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 8.[provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,626,092 Y406* probably null Het
9530053A07Rik C T 7: 28,137,213 R186C probably damaging Het
Acadvl T C 11: 70,014,333 D109G probably benign Het
Adam24 G A 8: 40,681,503 G670E probably damaging Het
Angpt1 T C 15: 42,459,740 M378V probably benign Het
Ankrd33 G A 15: 101,117,112 probably null Het
Apol7b G A 15: 77,423,425 T290I probably benign Het
Atg4a-ps A G 3: 103,645,864 W54R probably damaging Het
B3glct A G 5: 149,739,604 probably null Het
Bmp7 A G 2: 172,872,913 S368P probably damaging Het
Boc A G 16: 44,491,791 V636A probably damaging Het
Cacna1i G A 15: 80,374,801 R1237H probably damaging Het
Cdcp1 T C 9: 123,173,915 D697G probably benign Het
Cep85l T C 10: 53,349,098 T132A probably benign Het
Ces1b T A 8: 93,060,410 Y447F probably damaging Het
Cntn4 A T 6: 106,697,583 T1015S probably benign Het
Eea1 T G 10: 96,002,879 probably null Het
Gm12800 G A 4: 101,910,094 C180Y possibly damaging Het
Gm4788 T G 1: 139,731,653 N642H possibly damaging Het
Hipk1 A T 3: 103,777,512 N262K possibly damaging Het
Jmjd8 G A 17: 25,829,052 R41H possibly damaging Het
Klhl3 T A 13: 58,030,445 T344S probably damaging Het
Krt39 T C 11: 99,519,821 D175G probably damaging Het
Map4k1 A G 7: 28,986,802 Y81C probably damaging Het
Mpdu1 T A 11: 69,658,585 T95S probably benign Het
Ndufaf5 T A 2: 140,188,780 Y195* probably null Het
Olfr1141 A G 2: 87,753,879 V38A probably benign Het
Olfr1224-ps1 G A 2: 89,156,813 R121C possibly damaging Het
Olfr617 T A 7: 103,584,520 I166N possibly damaging Het
Olfr621-ps1 A T 7: 103,629,583 F126I probably benign Het
Olfr984 T C 9: 40,101,356 I45V probably benign Het
Oxgr1 T A 14: 120,022,019 I259F possibly damaging Het
Pcdhb9 T A 18: 37,401,917 D321E probably benign Het
Pi4kb G T 3: 94,993,150 R392L probably damaging Het
Prss41 T C 17: 23,837,648 K151R probably benign Het
Rev3l T A 10: 39,821,481 V658D probably benign Het
Snx4 A G 16: 33,294,738 I430V probably damaging Het
Tanc2 C T 11: 105,835,230 H407Y possibly damaging Het
Tcf25 G A 8: 123,400,698 probably null Het
Tsc22d1 A T 14: 76,506,483 K24* probably null Het
Vmn2r30 A G 7: 7,312,548 F762S probably damaging Het
Xrcc6 A G 15: 82,029,122 T319A probably benign Het
Zbtb1 C T 12: 76,386,211 R324* probably null Het
Zc3h7a A G 16: 11,145,671 Y729H probably damaging Het
Zfp329 C A 7: 12,806,530 probably benign Het
Zfp456 A T 13: 67,366,265 S441T probably benign Het
Other mutations in Myl12b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02114:Myl12b APN 17 70977169 missense possibly damaging 0.48
R3837:Myl12b UTSW 17 70974485 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTCATAGGTACCTCAGAACAAGG -3'
(R):5'- TGGGCAGACTTACTCTTCCC -3'

Sequencing Primer
(F):5'- GTACCTCAGAACAAGGGTTAAATC -3'
(R):5'- GTTAGGCAATGAGACCCCTG -3'
Posted On2018-11-06