Incidental Mutation 'R6905:Dgkd'
ID538716
Institutional Source Beutler Lab
Gene Symbol Dgkd
Ensembl Gene ENSMUSG00000070738
Gene Namediacylglycerol kinase, delta
Synonymsdgkd-2, DGKdelta, AI841987, D330025K09
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.755) question?
Stock #R6905 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location87853287-87945180 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87935375 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 48 (E48G)
Ref Sequence ENSEMBL: ENSMUSP00000139658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027517] [ENSMUST00000189448] [ENSMUST00000190061]
Predicted Effect probably damaging
Transcript: ENSMUST00000027517
AA Change: E875G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027517
Gene: ENSMUSG00000070738
AA Change: E875G

DomainStartEndE-ValueType
low complexity region 2 36 N/A INTRINSIC
PH 54 148 1.7e-16 SMART
C1 164 213 2.48e-15 SMART
low complexity region 221 232 N/A INTRINSIC
C1 236 286 8.56e-10 SMART
DAGKc 321 446 9.44e-62 SMART
low complexity region 691 710 N/A INTRINSIC
DAGKa 765 922 1.25e-98 SMART
low complexity region 1128 1139 N/A INTRINSIC
SAM 1148 1214 2.16e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185260
Predicted Effect probably benign
Transcript: ENSMUST00000189448
SMART Domains Protein: ENSMUSP00000139626
Gene: ENSMUSG00000070738

DomainStartEndE-ValueType
low complexity region 82 93 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190061
AA Change: E48G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139658
Gene: ENSMUSG00000070738
AA Change: E48G

DomainStartEndE-ValueType
DAGKa 1 95 7.6e-26 SMART
Blast:DAGKa 119 188 1e-23 BLAST
low complexity region 301 312 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.8%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic enzyme that phosphorylates diacylglycerol to produce phosphatidic acid. Diacylglycerol and phosphatidic acid are two lipids that act as second messengers in signaling cascades. Their cellular concentrations are regulated by the encoded protein, and so it is thought to play an important role in cellular signal transduction. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele are born with open eyelids and reduced body size, develop respiratory distress and die within 24 hrs of birth. Half of mice homozygous for a hypomorphic gene trap allele exhibit abnormal epileptic discharges and seizureswhile 9% of aging homozygotes develop tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025G04Rik G T 1: 151,980,438 N59K probably damaging Het
Abi3bp A G 16: 56,574,517 D196G probably damaging Het
Ankrd44 A G 1: 54,792,494 F50S probably damaging Het
Arid4a C T 12: 71,061,544 A41V probably benign Het
Cdk11b A T 4: 155,641,608 probably benign Het
Chrm5 C A 2: 112,479,556 C405F probably benign Het
Col6a4 A T 9: 106,060,318 probably null Het
Copb1 A C 7: 114,253,890 I24S probably benign Het
Ctsh A T 9: 90,062,766 K83N probably damaging Het
Dis3l2 A G 1: 87,044,839 T657A probably benign Het
Fam166a A G 2: 25,220,479 I100V probably benign Het
Flrt1 T A 19: 7,095,392 K597* probably null Het
Ifit1bl2 T C 19: 34,619,590 S209G possibly damaging Het
Ifrd2 T C 9: 107,587,890 M1T probably null Het
Ighv8-12 T C 12: 115,648,085 Y73C probably benign Het
Klhl21 C A 4: 152,009,727 A262E probably benign Het
L3mbtl4 A T 17: 68,777,888 Y598F probably benign Het
Lad1 A G 1: 135,827,880 K298R probably benign Het
Map2k2 A G 10: 81,108,867 D71G probably damaging Het
Megf8 T A 7: 25,337,932 H752Q probably benign Het
Mms22l A T 4: 24,503,107 M200L probably benign Het
Mup5 C A 4: 61,833,103 D103Y possibly damaging Het
Nes C T 3: 87,978,678 P1371S probably damaging Het
Olfr1257 A T 2: 89,881,708 D294V probably benign Het
Olfr1315-ps1 A T 2: 112,110,358 M298K probably damaging Het
Olfr619 A T 7: 103,604,367 T238S probably benign Het
Osbpl3 T C 6: 50,351,882 I114V probably damaging Het
Pank3 T C 11: 35,776,412 Y119H probably benign Het
Pcdhb15 C T 18: 37,474,695 L327F possibly damaging Het
Pnpla8 T C 12: 44,283,553 V78A probably damaging Het
Pqlc2 A G 4: 139,306,441 probably null Het
Rbm14 A G 19: 4,803,236 probably benign Het
Rev3l G A 10: 39,817,327 V468M probably benign Het
Ripk1 A G 13: 34,027,990 I428V probably benign Het
Rps5 T C 7: 12,925,858 V147A probably damaging Het
Rps6ka2 T A 17: 7,227,941 I9N probably damaging Het
Samd9l A T 6: 3,375,387 F625I probably damaging Het
Sh3bp1 A G 15: 78,905,030 D196G probably benign Het
Smg7 A T 1: 152,850,006 probably null Het
Stap1 G A 5: 86,090,922 E150K possibly damaging Het
Ticrr T C 7: 79,665,850 I284T probably benign Het
Tm4sf1 T C 3: 57,294,909 probably benign Het
Traf4 C T 11: 78,160,442 R296Q probably benign Het
Trav7d-4 G T 14: 52,770,313 A88S possibly damaging Het
Vwde T C 6: 13,205,927 E207G probably damaging Het
Other mutations in Dgkd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01529:Dgkd APN 1 87880411 missense probably damaging 1.00
IGL01531:Dgkd APN 1 87880411 missense probably damaging 1.00
IGL01627:Dgkd APN 1 87880428 missense probably damaging 1.00
IGL01720:Dgkd APN 1 87936765 missense probably damaging 1.00
IGL01915:Dgkd APN 1 87926058 missense possibly damaging 0.86
IGL01941:Dgkd APN 1 87924559 missense probably damaging 0.99
IGL01951:Dgkd APN 1 87916916 missense probably damaging 1.00
IGL02244:Dgkd APN 1 87915141 missense probably benign 0.27
IGL02581:Dgkd APN 1 87918002 splice site probably benign
IGL02852:Dgkd APN 1 87935413 missense probably damaging 1.00
IGL02893:Dgkd APN 1 87915208 splice site probably benign
IGL03367:Dgkd APN 1 87940308 critical splice donor site probably null
R0014:Dgkd UTSW 1 87881881 missense probably damaging 1.00
R0016:Dgkd UTSW 1 87917952 missense probably benign 0.02
R0219:Dgkd UTSW 1 87938274 splice site probably benign
R0496:Dgkd UTSW 1 87936900 missense probably null 0.83
R0559:Dgkd UTSW 1 87915104 missense probably damaging 1.00
R0591:Dgkd UTSW 1 87915104 missense probably damaging 1.00
R1270:Dgkd UTSW 1 87934125 missense probably damaging 0.96
R1599:Dgkd UTSW 1 87881886 missense possibly damaging 0.58
R1658:Dgkd UTSW 1 87926268 missense probably damaging 1.00
R1745:Dgkd UTSW 1 87932044 critical splice donor site probably null
R1959:Dgkd UTSW 1 87929827 missense possibly damaging 0.47
R1960:Dgkd UTSW 1 87929827 missense possibly damaging 0.47
R2044:Dgkd UTSW 1 87927691 missense probably benign
R2148:Dgkd UTSW 1 87881921 missense probably damaging 1.00
R2232:Dgkd UTSW 1 87929742 missense probably benign 0.05
R2266:Dgkd UTSW 1 87927818 unclassified probably benign
R3774:Dgkd UTSW 1 87936300 missense probably damaging 1.00
R4004:Dgkd UTSW 1 87935423 missense possibly damaging 0.56
R4005:Dgkd UTSW 1 87935423 missense possibly damaging 0.56
R4133:Dgkd UTSW 1 87941501 critical splice donor site probably null
R4235:Dgkd UTSW 1 87931982 nonsense probably null
R4644:Dgkd UTSW 1 87936294 missense probably damaging 1.00
R4747:Dgkd UTSW 1 87934167 missense probably damaging 1.00
R4864:Dgkd UTSW 1 87916838 missense possibly damaging 0.94
R5334:Dgkd UTSW 1 87938267 critical splice donor site probably null
R5365:Dgkd UTSW 1 87935416 missense probably damaging 1.00
R5495:Dgkd UTSW 1 87926872 missense probably damaging 1.00
R5514:Dgkd UTSW 1 87934110 missense probably damaging 1.00
R5729:Dgkd UTSW 1 87936332 nonsense probably null
R5766:Dgkd UTSW 1 87880449 nonsense probably null
R6133:Dgkd UTSW 1 87938240 missense possibly damaging 0.93
R6137:Dgkd UTSW 1 87936381 missense possibly damaging 0.48
R6198:Dgkd UTSW 1 87924208 missense probably damaging 1.00
R6297:Dgkd UTSW 1 87926144 missense possibly damaging 0.94
R6577:Dgkd UTSW 1 87940240 missense probably damaging 1.00
R6846:Dgkd UTSW 1 87925691 splice site probably null
R7369:Dgkd UTSW 1 87921622 missense probably damaging 1.00
R7763:Dgkd UTSW 1 87926949 missense probably benign
Z1176:Dgkd UTSW 1 87927810 missense probably benign 0.05
Z1177:Dgkd UTSW 1 87916886 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCATTGGGCTTCTGGGTAAC -3'
(R):5'- TTGGGTCTCTACTGTGAGCAAATC -3'

Sequencing Primer
(F):5'- GATACCCAACCCTGCACTTCATTTAC -3'
(R):5'- GTCTCTACTGTGAGCAAATCCAAGC -3'
Posted On2018-11-06