Incidental Mutation 'R6905:Fam166a'
ID538720
Institutional Source Beutler Lab
Gene Symbol Fam166a
Ensembl Gene ENSMUSG00000026969
Gene Namefamily with sequence similarity 166, member A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R6905 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location25218745-25222280 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25220479 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 100 (I100V)
Ref Sequence ENSEMBL: ENSMUSP00000028346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028346] [ENSMUST00000043584]
Predicted Effect probably benign
Transcript: ENSMUST00000028346
AA Change: I100V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000028346
Gene: ENSMUSG00000026969
AA Change: I100V

DomainStartEndE-ValueType
Pfam:DUF2475 13 71 8.1e-16 PFAM
low complexity region 130 139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000043584
SMART Domains Protein: ENSMUSP00000042342
Gene: ENSMUSG00000036752

DomainStartEndE-ValueType
Tubulin 47 244 1.04e-67 SMART
Tubulin_C 246 383 3.89e-49 SMART
low complexity region 428 445 N/A INTRINSIC
Meta Mutation Damage Score 0.0785 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.8%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025G04Rik G T 1: 151,980,438 N59K probably damaging Het
Abi3bp A G 16: 56,574,517 D196G probably damaging Het
Ankrd44 A G 1: 54,792,494 F50S probably damaging Het
Arid4a C T 12: 71,061,544 A41V probably benign Het
Cdk11b A T 4: 155,641,608 probably benign Het
Chrm5 C A 2: 112,479,556 C405F probably benign Het
Col6a4 A T 9: 106,060,318 probably null Het
Copb1 A C 7: 114,253,890 I24S probably benign Het
Ctsh A T 9: 90,062,766 K83N probably damaging Het
Dgkd A G 1: 87,935,375 E48G probably damaging Het
Dis3l2 A G 1: 87,044,839 T657A probably benign Het
Flrt1 T A 19: 7,095,392 K597* probably null Het
Ifit1bl2 T C 19: 34,619,590 S209G possibly damaging Het
Ifrd2 T C 9: 107,587,890 M1T probably null Het
Ighv8-12 T C 12: 115,648,085 Y73C probably benign Het
Klhl21 C A 4: 152,009,727 A262E probably benign Het
L3mbtl4 A T 17: 68,777,888 Y598F probably benign Het
Lad1 A G 1: 135,827,880 K298R probably benign Het
Map2k2 A G 10: 81,108,867 D71G probably damaging Het
Megf8 T A 7: 25,337,932 H752Q probably benign Het
Mms22l A T 4: 24,503,107 M200L probably benign Het
Mup5 C A 4: 61,833,103 D103Y possibly damaging Het
Nes C T 3: 87,978,678 P1371S probably damaging Het
Olfr1257 A T 2: 89,881,708 D294V probably benign Het
Olfr1315-ps1 A T 2: 112,110,358 M298K probably damaging Het
Olfr619 A T 7: 103,604,367 T238S probably benign Het
Osbpl3 T C 6: 50,351,882 I114V probably damaging Het
Pank3 T C 11: 35,776,412 Y119H probably benign Het
Pcdhb15 C T 18: 37,474,695 L327F possibly damaging Het
Pnpla8 T C 12: 44,283,553 V78A probably damaging Het
Pqlc2 A G 4: 139,306,441 probably null Het
Rbm14 A G 19: 4,803,236 probably benign Het
Rev3l G A 10: 39,817,327 V468M probably benign Het
Ripk1 A G 13: 34,027,990 I428V probably benign Het
Rps5 T C 7: 12,925,858 V147A probably damaging Het
Rps6ka2 T A 17: 7,227,941 I9N probably damaging Het
Samd9l A T 6: 3,375,387 F625I probably damaging Het
Sh3bp1 A G 15: 78,905,030 D196G probably benign Het
Smg7 A T 1: 152,850,006 probably null Het
Stap1 G A 5: 86,090,922 E150K possibly damaging Het
Ticrr T C 7: 79,665,850 I284T probably benign Het
Tm4sf1 T C 3: 57,294,909 probably benign Het
Traf4 C T 11: 78,160,442 R296Q probably benign Het
Trav7d-4 G T 14: 52,770,313 A88S possibly damaging Het
Vwde T C 6: 13,205,927 E207G probably damaging Het
Other mutations in Fam166a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01344:Fam166a APN 2 25220333 missense possibly damaging 0.90
IGL01712:Fam166a APN 2 25218792 unclassified probably benign
IGL03056:Fam166a APN 2 25221355 missense possibly damaging 0.73
IGL03232:Fam166a APN 2 25221739 nonsense probably null
R0368:Fam166a UTSW 2 25220673 missense probably benign
R0761:Fam166a UTSW 2 25220123 unclassified probably benign
R1997:Fam166a UTSW 2 25220205 missense probably damaging 1.00
R2106:Fam166a UTSW 2 25220651 missense probably damaging 0.99
R4575:Fam166a UTSW 2 25220288 missense probably benign 0.00
R4576:Fam166a UTSW 2 25220288 missense probably benign 0.00
R4577:Fam166a UTSW 2 25220288 missense probably benign 0.00
R4578:Fam166a UTSW 2 25220288 missense probably benign 0.00
R5829:Fam166a UTSW 2 25218857 critical splice donor site probably null
R5896:Fam166a UTSW 2 25220566 missense probably benign
R6618:Fam166a UTSW 2 25220623 missense probably benign 0.02
R7178:Fam166a UTSW 2 25220240 missense probably damaging 0.99
R7636:Fam166a UTSW 2 25218820 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCCAAGTTCATTGAGGACTTCAG -3'
(R):5'- TCTTCCCCATATGCCAGCAG -3'

Sequencing Primer
(F):5'- GTTCATTGAGGACTTCAGCAAATCC -3'
(R):5'- CATATGCCAGCAGTAGACCTGG -3'
Posted On2018-11-06