Incidental Mutation 'R6905:Pnpla8'
ID538746
Institutional Source Beutler Lab
Gene Symbol Pnpla8
Ensembl Gene ENSMUSG00000036257
Gene Namepatatin-like phospholipase domain containing 8
Synonyms1200006O19Rik, iPLA2 gamma
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock #R6905 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location44221370-44322532 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44283553 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 78 (V78A)
Ref Sequence ENSEMBL: ENSMUSP00000120877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043082] [ENSMUST00000122902] [ENSMUST00000125757] [ENSMUST00000143771] [ENSMUST00000218954]
Predicted Effect probably damaging
Transcript: ENSMUST00000043082
AA Change: V296A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043286
Gene: ENSMUSG00000036257
AA Change: V296A

DomainStartEndE-ValueType
SCOP:d1gw5a_ 332 430 2e-3 SMART
Pfam:Patatin 439 634 1.4e-26 PFAM
low complexity region 664 675 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122902
AA Change: V78A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120877
Gene: ENSMUSG00000036257
AA Change: V78A

DomainStartEndE-ValueType
SCOP:d1gw5a_ 114 212 2e-3 SMART
Pfam:Patatin 221 416 3e-27 PFAM
low complexity region 446 457 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125757
Predicted Effect possibly damaging
Transcript: ENSMUST00000143771
AA Change: V296A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122560
Gene: ENSMUSG00000036257
AA Change: V296A

DomainStartEndE-ValueType
SCOP:d1gw5a_ 332 430 3e-3 SMART
Pfam:Patatin 439 658 7.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218954
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.8%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the patatin-like phospholipase domain containing protein family. Members of this family are phospholipases which catalyze the cleavage of fatty acids from membrane phospholipids. The product of this gene is a calcium-independent phospholipase. Mutations in this gene have been associated with mitochondrial myopathy with lactic acidosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit some female-specific embryonic lethality, reduced body weight and temperature, cold intolerance, decreased exercise tolerance and decreased mitochondria function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025G04Rik G T 1: 151,980,438 N59K probably damaging Het
Abi3bp A G 16: 56,574,517 D196G probably damaging Het
Ankrd44 A G 1: 54,792,494 F50S probably damaging Het
Arid4a C T 12: 71,061,544 A41V probably benign Het
Cdk11b A T 4: 155,641,608 probably benign Het
Chrm5 C A 2: 112,479,556 C405F probably benign Het
Col6a4 A T 9: 106,060,318 probably null Het
Copb1 A C 7: 114,253,890 I24S probably benign Het
Ctsh A T 9: 90,062,766 K83N probably damaging Het
Dgkd A G 1: 87,935,375 E48G probably damaging Het
Dis3l2 A G 1: 87,044,839 T657A probably benign Het
Fam166a A G 2: 25,220,479 I100V probably benign Het
Flrt1 T A 19: 7,095,392 K597* probably null Het
Ifit1bl2 T C 19: 34,619,590 S209G possibly damaging Het
Ifrd2 T C 9: 107,587,890 M1T probably null Het
Ighv8-12 T C 12: 115,648,085 Y73C probably benign Het
Klhl21 C A 4: 152,009,727 A262E probably benign Het
L3mbtl4 A T 17: 68,777,888 Y598F probably benign Het
Lad1 A G 1: 135,827,880 K298R probably benign Het
Map2k2 A G 10: 81,108,867 D71G probably damaging Het
Megf8 T A 7: 25,337,932 H752Q probably benign Het
Mms22l A T 4: 24,503,107 M200L probably benign Het
Mup5 C A 4: 61,833,103 D103Y possibly damaging Het
Nes C T 3: 87,978,678 P1371S probably damaging Het
Olfr1257 A T 2: 89,881,708 D294V probably benign Het
Olfr1315-ps1 A T 2: 112,110,358 M298K probably damaging Het
Olfr619 A T 7: 103,604,367 T238S probably benign Het
Osbpl3 T C 6: 50,351,882 I114V probably damaging Het
Pank3 T C 11: 35,776,412 Y119H probably benign Het
Pcdhb15 C T 18: 37,474,695 L327F possibly damaging Het
Pqlc2 A G 4: 139,306,441 probably null Het
Rbm14 A G 19: 4,803,236 probably benign Het
Rev3l G A 10: 39,817,327 V468M probably benign Het
Ripk1 A G 13: 34,027,990 I428V probably benign Het
Rps5 T C 7: 12,925,858 V147A probably damaging Het
Rps6ka2 T A 17: 7,227,941 I9N probably damaging Het
Samd9l A T 6: 3,375,387 F625I probably damaging Het
Sh3bp1 A G 15: 78,905,030 D196G probably benign Het
Smg7 A T 1: 152,850,006 probably null Het
Stap1 G A 5: 86,090,922 E150K possibly damaging Het
Ticrr T C 7: 79,665,850 I284T probably benign Het
Tm4sf1 T C 3: 57,294,909 probably benign Het
Traf4 C T 11: 78,160,442 R296Q probably benign Het
Trav7d-4 G T 14: 52,770,313 A88S possibly damaging Het
Vwde T C 6: 13,205,927 E207G probably damaging Het
Other mutations in Pnpla8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Pnpla8 APN 12 44283069 missense probably benign 0.00
IGL01477:Pnpla8 APN 12 44283658 missense probably damaging 0.98
IGL01963:Pnpla8 APN 12 44296033 missense possibly damaging 0.88
IGL02877:Pnpla8 APN 12 44283465 missense probably benign 0.13
IGL03085:Pnpla8 APN 12 44311522 missense probably benign 0.01
IGL03335:Pnpla8 APN 12 44283164 missense probably benign 0.03
IGL03396:Pnpla8 APN 12 44283526 missense probably benign 0.01
Bantamweight UTSW 12 44304947 missense possibly damaging 0.65
featherweight UTSW 12 44295970 nonsense probably null
freerange UTSW 12 44283247 missense possibly damaging 0.94
R0063:Pnpla8 UTSW 12 44282832 missense probably damaging 1.00
R0063:Pnpla8 UTSW 12 44282832 missense probably damaging 1.00
R0172:Pnpla8 UTSW 12 44311328 missense probably damaging 1.00
R0524:Pnpla8 UTSW 12 44283618 nonsense probably null
R0608:Pnpla8 UTSW 12 44283463 missense probably benign 0.36
R0811:Pnpla8 UTSW 12 44283405 missense probably benign 0.03
R0812:Pnpla8 UTSW 12 44283405 missense probably benign 0.03
R1120:Pnpla8 UTSW 12 44304947 missense possibly damaging 0.65
R2127:Pnpla8 UTSW 12 44308057 missense probably benign 0.37
R2392:Pnpla8 UTSW 12 44311504 missense probably damaging 1.00
R4411:Pnpla8 UTSW 12 44283442 missense probably benign 0.00
R4714:Pnpla8 UTSW 12 44295913 missense probably damaging 1.00
R5446:Pnpla8 UTSW 12 44290585 missense possibly damaging 0.94
R5585:Pnpla8 UTSW 12 44283064 missense probably benign 0.06
R5752:Pnpla8 UTSW 12 44282887 missense probably benign 0.04
R5914:Pnpla8 UTSW 12 44295970 nonsense probably null
R6125:Pnpla8 UTSW 12 44307989 missense possibly damaging 0.65
R6135:Pnpla8 UTSW 12 44282887 missense probably benign 0.04
R6224:Pnpla8 UTSW 12 44283028 missense possibly damaging 0.82
R6933:Pnpla8 UTSW 12 44283427 missense probably benign 0.00
R6983:Pnpla8 UTSW 12 44283247 missense possibly damaging 0.94
R7334:Pnpla8 UTSW 12 44311503 missense probably damaging 1.00
R7529:Pnpla8 UTSW 12 44283180 missense probably benign 0.00
R7996:Pnpla8 UTSW 12 44282983 nonsense probably null
Z1176:Pnpla8 UTSW 12 44295990 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGGAAATCCAGTTCTCCAGGC -3'
(R):5'- CTCACTCTTGCAATAATCTGTAAGG -3'

Sequencing Primer
(F):5'- AGTTCTCCAGGCCCTGACAC -3'
(R):5'- GGTTAACATTTCTTAAGCCCACACTG -3'
Posted On2018-11-06