Mutagenetix > Incidental Mutations

Incidental Mutation 'R6905:Arid4a'

538747

Institutional Source

Beutler Lab

Gene Symbol

Arid4a

Ensembl Gene

ENSMUSG00000048118

Gene Name

AT rich interactive domain 4A (RBP1-like)

Synonyms

Rbbp1, A630067N03Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6905 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

71015990-71098592 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 71061544 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 41 (A41V)

Ref Sequence

ENSEMBL: ENSMUSP00000121319 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046305] [ENSMUST00000135709]

Predicted Effect

probably benign
Transcript: ENSMUST00000046305
AA Change: A363V

PolyPhen 2 Score 0.429 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000035512
Gene: ENSMUSG00000048118
AA Change: A363V

Domain	Start	End	E-Value	Type
low complexity region	28	43	N/A	INTRINSIC
TUDOR	58	114	3.6e-12	SMART
low complexity region	152	167	N/A	INTRINSIC
Pfam:RBB1NT	170	262	4e-32	PFAM
ARID	306	397	6.7e-37	SMART
BRIGHT	310	402	2.3e-40	SMART
low complexity region	411	422	N/A	INTRINSIC
CHROMO	483	652	6.8e-6	SMART
low complexity region	690	707	N/A	INTRINSIC
low complexity region	965	976	N/A	INTRINSIC
low complexity region	991	1003	N/A	INTRINSIC
coiled coil region	1185	1224	N/A	INTRINSIC
low complexity region	1229	1252	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000135709
AA Change: A41V

PolyPhen 2 Score 0.429 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000121319
Gene: ENSMUSG00000048118
AA Change: A41V

Domain	Start	End	E-Value	Type
ARID	1	75	1.02e-16	SMART
BRIGHT	1	80	2.05e-23	SMART
low complexity region	89	100	N/A	INTRINSIC
CHROMO	161	330	1.08e-3	SMART
low complexity region	368	385	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 99.0%
20x: 96.8%

Validation Efficiency

98% (44/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ubiquitously expressed nuclear protein. It binds directly, with several other proteins, to retinoblastoma protein (pRB) which regulates cell proliferation. pRB represses transcription by recruiting the encoded protein. This protein, in turn, serves as a bridging molecule to recruit HDACs and, in addition, provides a second HDAC-independent repression function. The encoded protein possesses transcriptional repression activity. Multiple alternatively spliced transcripts have been observed for this gene, although not all transcript variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered DNA methylation patterns, disrupted hematopoiesis and a portion develop acute myeloid leukemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700025G04Rik	G	T	1: 151,980,438	N59K	probably damaging	Het
Abi3bp	A	G	16: 56,574,517	D196G	probably damaging	Het
Ankrd44	A	G	1: 54,792,494	F50S	probably damaging	Het
Cdk11b	A	T	4: 155,641,608		probably benign	Het
Chrm5	C	A	2: 112,479,556	C405F	probably benign	Het
Col6a4	A	T	9: 106,060,318		probably null	Het
Copb1	A	C	7: 114,253,890	I24S	probably benign	Het
Ctsh	A	T	9: 90,062,766	K83N	probably damaging	Het
Dgkd	A	G	1: 87,935,375	E48G	probably damaging	Het
Dis3l2	A	G	1: 87,044,839	T657A	probably benign	Het
Fam166a	A	G	2: 25,220,479	I100V	probably benign	Het
Flrt1	T	A	19: 7,095,392	K597*	probably null	Het
Ifit1bl2	T	C	19: 34,619,590	S209G	possibly damaging	Het
Ifrd2	T	C	9: 107,587,890	M1T	probably null	Het
Ighv8-12	T	C	12: 115,648,085	Y73C	probably benign	Het
Klhl21	C	A	4: 152,009,727	A262E	probably benign	Het
L3mbtl4	A	T	17: 68,777,888	Y598F	probably benign	Het
Lad1	A	G	1: 135,827,880	K298R	probably benign	Het
Map2k2	A	G	10: 81,108,867	D71G	probably damaging	Het
Megf8	T	A	7: 25,337,932	H752Q	probably benign	Het
Mms22l	A	T	4: 24,503,107	M200L	probably benign	Het
Mup5	C	A	4: 61,833,103	D103Y	possibly damaging	Het
Nes	C	T	3: 87,978,678	P1371S	probably damaging	Het
Olfr1257	A	T	2: 89,881,708	D294V	probably benign	Het
Olfr1315-ps1	A	T	2: 112,110,358	M298K	probably damaging	Het
Olfr619	A	T	7: 103,604,367	T238S	probably benign	Het
Osbpl3	T	C	6: 50,351,882	I114V	probably damaging	Het
Pank3	T	C	11: 35,776,412	Y119H	probably benign	Het
Pcdhb15	C	T	18: 37,474,695	L327F	possibly damaging	Het
Pnpla8	T	C	12: 44,283,553	V78A	probably damaging	Het
Pqlc2	A	G	4: 139,306,441		probably null	Het
Rbm14	A	G	19: 4,803,236		probably benign	Het
Rev3l	G	A	10: 39,817,327	V468M	probably benign	Het
Ripk1	A	G	13: 34,027,990	I428V	probably benign	Het
Rps5	T	C	7: 12,925,858	V147A	probably damaging	Het
Rps6ka2	T	A	17: 7,227,941	I9N	probably damaging	Het
Samd9l	A	T	6: 3,375,387	F625I	probably damaging	Het
Sh3bp1	A	G	15: 78,905,030	D196G	probably benign	Het
Smg7	A	T	1: 152,850,006		probably null	Het
Stap1	G	A	5: 86,090,922	E150K	possibly damaging	Het
Ticrr	T	C	7: 79,665,850	I284T	probably benign	Het
Tm4sf1	T	C	3: 57,294,909		probably benign	Het
Traf4	C	T	11: 78,160,442	R296Q	probably benign	Het
Trav7d-4	G	T	14: 52,770,313	A88S	possibly damaging	Het
Vwde	T	C	6: 13,205,927	E207G	probably damaging	Het

Other mutations in Arid4a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00479:Arid4a	APN	12	71072593	missense	probably damaging	1.00
IGL00546:Arid4a	APN	12	71075671	missense	probably benign
IGL00553:Arid4a	APN	12	71075977	missense	probably benign	0.04
IGL00708:Arid4a	APN	12	71072728	missense	probably benign	0.02
IGL00847:Arid4a	APN	12	71075718	missense	probably damaging	1.00
IGL01112:Arid4a	APN	12	71072733	critical splice donor site	probably null
IGL01456:Arid4a	APN	12	71067262	missense	probably benign	0.00
IGL01505:Arid4a	APN	12	71037115	missense	probably damaging	1.00
IGL01555:Arid4a	APN	12	71061527	splice site	probably benign
IGL01631:Arid4a	APN	12	71022262	splice site	probably benign
IGL02958:Arid4a	APN	12	71097563	missense	probably benign	0.01
IGL03087:Arid4a	APN	12	71075245	missense	possibly damaging	0.94
IGL03111:Arid4a	APN	12	71039966	missense	probably damaging	1.00
IGL03234:Arid4a	APN	12	71045060	missense	probably benign	0.34
After_8	UTSW	12	71023498	critical splice acceptor site	probably null
ariano	UTSW	12	71069860	nonsense	probably null
guava	UTSW	12	71072632	missense	probably damaging	0.99
limoncello	UTSW	12	71067341	splice site	probably null
Sahara	UTSW	12	71060115	nonsense	probably null
Under_8	UTSW	12	71063206	missense	probably benign	0.10
R0047:Arid4a	UTSW	12	71075419	missense	probably damaging	1.00
R0047:Arid4a	UTSW	12	71075419	missense	probably damaging	1.00
R0270:Arid4a	UTSW	12	71072632	missense	probably damaging	0.99
R0310:Arid4a	UTSW	12	71075830	missense	probably benign	0.05
R0504:Arid4a	UTSW	12	71047214	missense	probably damaging	1.00
R1061:Arid4a	UTSW	12	71074955	missense	probably damaging	1.00
R1087:Arid4a	UTSW	12	71075338	missense	probably benign	0.01
R1169:Arid4a	UTSW	12	71075338	missense	probably benign	0.01
R1171:Arid4a	UTSW	12	71075338	missense	probably benign	0.01
R1531:Arid4a	UTSW	12	71076005	missense	probably benign	0.01
R1674:Arid4a	UTSW	12	71075338	missense	probably benign	0.01
R1676:Arid4a	UTSW	12	71075338	missense	probably benign	0.01
R1768:Arid4a	UTSW	12	71075338	missense	probably benign	0.01
R1833:Arid4a	UTSW	12	71075466	missense	possibly damaging	0.50
R1878:Arid4a	UTSW	12	71087589	missense	probably damaging	1.00
R2290:Arid4a	UTSW	12	71061541	missense	probably damaging	1.00
R2292:Arid4a	UTSW	12	71061541	missense	probably damaging	1.00
R2871:Arid4a	UTSW	12	71022260	critical splice donor site	probably null
R2871:Arid4a	UTSW	12	71022260	critical splice donor site	probably null
R3411:Arid4a	UTSW	12	71061525	splice site	probably benign
R3768:Arid4a	UTSW	12	71067119	missense	probably damaging	1.00
R3838:Arid4a	UTSW	12	71075785	missense	possibly damaging	0.94
R4320:Arid4a	UTSW	12	71069995	missense	possibly damaging	0.69
R4589:Arid4a	UTSW	12	71069964	missense	probably damaging	1.00
R4829:Arid4a	UTSW	12	71023498	critical splice acceptor site	probably null
R4862:Arid4a	UTSW	12	71075947	missense	probably damaging	0.96
R4952:Arid4a	UTSW	12	71023525	missense	possibly damaging	0.64
R5072:Arid4a	UTSW	12	71045079	missense	probably benign	0.08
R5423:Arid4a	UTSW	12	71069860	nonsense	probably null
R5767:Arid4a	UTSW	12	71060093	missense	probably damaging	1.00
R5911:Arid4a	UTSW	12	71069973	missense	probably damaging	1.00
R5952:Arid4a	UTSW	12	71063206	missense	probably benign	0.10
R6088:Arid4a	UTSW	12	71022236	missense	probably damaging	0.99
R6235:Arid4a	UTSW	12	71069772	splice site	probably null
R6277:Arid4a	UTSW	12	71039891	missense	possibly damaging	0.49
R6455:Arid4a	UTSW	12	71075088	missense	probably benign	0.04
R6523:Arid4a	UTSW	12	71067341	splice site	probably null
R6701:Arid4a	UTSW	12	71087512	missense	probably damaging	1.00
R6812:Arid4a	UTSW	12	71047263	missense	possibly damaging	0.92
R6815:Arid4a	UTSW	12	71017082	splice site	probably null
R6837:Arid4a	UTSW	12	71075515	missense	probably benign
R6858:Arid4a	UTSW	12	71023509	missense	probably benign	0.01
R6895:Arid4a	UTSW	12	71063302	missense	probably benign	0.18
R6901:Arid4a	UTSW	12	71067137	missense	probably damaging	0.99
R7387:Arid4a	UTSW	12	71087496	missense	probably damaging	1.00
R7570:Arid4a	UTSW	12	71063142	nonsense	probably null
R7772:Arid4a	UTSW	12	71061589	missense	possibly damaging	0.65
R8194:Arid4a	UTSW	12	71060115	nonsense	probably null
R8206:Arid4a	UTSW	12	71086587	missense	probably damaging	1.00
R8552:Arid4a	UTSW	12	71060075	missense	probably benign
Z1176:Arid4a	UTSW	12	71039920	missense	possibly damaging	0.89
Z1177:Arid4a	UTSW	12	71075637	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- GCAATGTAAGTATACCGTTGCTT -3'
(R):5'- GCAGGAGGGGTACTGTTCAA -3'

Sequencing Primer
(F):5'- ATACCGTTGCTTTAGAAGTATGTG -3'
(R):5'- CTGCAATTAAAGGCCTGTGC -3'

Posted On

2018-11-06