Incidental Mutation 'R6905:Arid4a'
ID538747
Institutional Source Beutler Lab
Gene Symbol Arid4a
Ensembl Gene ENSMUSG00000048118
Gene NameAT rich interactive domain 4A (RBP1-like)
SynonymsRbbp1, A630067N03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6905 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location71015990-71098592 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 71061544 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 41 (A41V)
Ref Sequence ENSEMBL: ENSMUSP00000121319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046305] [ENSMUST00000135709]
Predicted Effect probably benign
Transcript: ENSMUST00000046305
AA Change: A363V

PolyPhen 2 Score 0.429 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000035512
Gene: ENSMUSG00000048118
AA Change: A363V

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
TUDOR 58 114 3.6e-12 SMART
low complexity region 152 167 N/A INTRINSIC
Pfam:RBB1NT 170 262 4e-32 PFAM
ARID 306 397 6.7e-37 SMART
BRIGHT 310 402 2.3e-40 SMART
low complexity region 411 422 N/A INTRINSIC
CHROMO 483 652 6.8e-6 SMART
low complexity region 690 707 N/A INTRINSIC
low complexity region 965 976 N/A INTRINSIC
low complexity region 991 1003 N/A INTRINSIC
coiled coil region 1185 1224 N/A INTRINSIC
low complexity region 1229 1252 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135709
AA Change: A41V

PolyPhen 2 Score 0.429 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000121319
Gene: ENSMUSG00000048118
AA Change: A41V

DomainStartEndE-ValueType
ARID 1 75 1.02e-16 SMART
BRIGHT 1 80 2.05e-23 SMART
low complexity region 89 100 N/A INTRINSIC
CHROMO 161 330 1.08e-3 SMART
low complexity region 368 385 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.8%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ubiquitously expressed nuclear protein. It binds directly, with several other proteins, to retinoblastoma protein (pRB) which regulates cell proliferation. pRB represses transcription by recruiting the encoded protein. This protein, in turn, serves as a bridging molecule to recruit HDACs and, in addition, provides a second HDAC-independent repression function. The encoded protein possesses transcriptional repression activity. Multiple alternatively spliced transcripts have been observed for this gene, although not all transcript variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered DNA methylation patterns, disrupted hematopoiesis and a portion develop acute myeloid leukemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025G04Rik G T 1: 151,980,438 N59K probably damaging Het
Abi3bp A G 16: 56,574,517 D196G probably damaging Het
Ankrd44 A G 1: 54,792,494 F50S probably damaging Het
Cdk11b A T 4: 155,641,608 probably benign Het
Chrm5 C A 2: 112,479,556 C405F probably benign Het
Col6a4 A T 9: 106,060,318 probably null Het
Copb1 A C 7: 114,253,890 I24S probably benign Het
Ctsh A T 9: 90,062,766 K83N probably damaging Het
Dgkd A G 1: 87,935,375 E48G probably damaging Het
Dis3l2 A G 1: 87,044,839 T657A probably benign Het
Fam166a A G 2: 25,220,479 I100V probably benign Het
Flrt1 T A 19: 7,095,392 K597* probably null Het
Ifit1bl2 T C 19: 34,619,590 S209G possibly damaging Het
Ifrd2 T C 9: 107,587,890 M1T probably null Het
Ighv8-12 T C 12: 115,648,085 Y73C probably benign Het
Klhl21 C A 4: 152,009,727 A262E probably benign Het
L3mbtl4 A T 17: 68,777,888 Y598F probably benign Het
Lad1 A G 1: 135,827,880 K298R probably benign Het
Map2k2 A G 10: 81,108,867 D71G probably damaging Het
Megf8 T A 7: 25,337,932 H752Q probably benign Het
Mms22l A T 4: 24,503,107 M200L probably benign Het
Mup5 C A 4: 61,833,103 D103Y possibly damaging Het
Nes C T 3: 87,978,678 P1371S probably damaging Het
Olfr1257 A T 2: 89,881,708 D294V probably benign Het
Olfr1315-ps1 A T 2: 112,110,358 M298K probably damaging Het
Olfr619 A T 7: 103,604,367 T238S probably benign Het
Osbpl3 T C 6: 50,351,882 I114V probably damaging Het
Pank3 T C 11: 35,776,412 Y119H probably benign Het
Pcdhb15 C T 18: 37,474,695 L327F possibly damaging Het
Pnpla8 T C 12: 44,283,553 V78A probably damaging Het
Pqlc2 A G 4: 139,306,441 probably null Het
Rbm14 A G 19: 4,803,236 probably benign Het
Rev3l G A 10: 39,817,327 V468M probably benign Het
Ripk1 A G 13: 34,027,990 I428V probably benign Het
Rps5 T C 7: 12,925,858 V147A probably damaging Het
Rps6ka2 T A 17: 7,227,941 I9N probably damaging Het
Samd9l A T 6: 3,375,387 F625I probably damaging Het
Sh3bp1 A G 15: 78,905,030 D196G probably benign Het
Smg7 A T 1: 152,850,006 probably null Het
Stap1 G A 5: 86,090,922 E150K possibly damaging Het
Ticrr T C 7: 79,665,850 I284T probably benign Het
Tm4sf1 T C 3: 57,294,909 probably benign Het
Traf4 C T 11: 78,160,442 R296Q probably benign Het
Trav7d-4 G T 14: 52,770,313 A88S possibly damaging Het
Vwde T C 6: 13,205,927 E207G probably damaging Het
Other mutations in Arid4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Arid4a APN 12 71072593 missense probably damaging 1.00
IGL00546:Arid4a APN 12 71075671 missense probably benign
IGL00553:Arid4a APN 12 71075977 missense probably benign 0.04
IGL00708:Arid4a APN 12 71072728 missense probably benign 0.02
IGL00847:Arid4a APN 12 71075718 missense probably damaging 1.00
IGL01112:Arid4a APN 12 71072733 critical splice donor site probably null
IGL01456:Arid4a APN 12 71067262 missense probably benign 0.00
IGL01505:Arid4a APN 12 71037115 missense probably damaging 1.00
IGL01555:Arid4a APN 12 71061527 splice site probably benign
IGL01631:Arid4a APN 12 71022262 splice site probably benign
IGL02958:Arid4a APN 12 71097563 missense probably benign 0.01
IGL03087:Arid4a APN 12 71075245 missense possibly damaging 0.94
IGL03111:Arid4a APN 12 71039966 missense probably damaging 1.00
IGL03234:Arid4a APN 12 71045060 missense probably benign 0.34
After_8 UTSW 12 71023498 critical splice acceptor site probably null
ariano UTSW 12 71069860 nonsense probably null
guava UTSW 12 71072632 missense probably damaging 0.99
limoncello UTSW 12 71067341 splice site probably null
Under_8 UTSW 12 71063206 missense probably benign 0.10
R0047:Arid4a UTSW 12 71075419 missense probably damaging 1.00
R0047:Arid4a UTSW 12 71075419 missense probably damaging 1.00
R0270:Arid4a UTSW 12 71072632 missense probably damaging 0.99
R0310:Arid4a UTSW 12 71075830 missense probably benign 0.05
R0504:Arid4a UTSW 12 71047214 missense probably damaging 1.00
R1061:Arid4a UTSW 12 71074955 missense probably damaging 1.00
R1087:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1169:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1171:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1531:Arid4a UTSW 12 71076005 missense probably benign 0.01
R1674:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1676:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1768:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1833:Arid4a UTSW 12 71075466 missense possibly damaging 0.50
R1878:Arid4a UTSW 12 71087589 missense probably damaging 1.00
R2290:Arid4a UTSW 12 71061541 missense probably damaging 1.00
R2292:Arid4a UTSW 12 71061541 missense probably damaging 1.00
R2871:Arid4a UTSW 12 71022260 critical splice donor site probably null
R2871:Arid4a UTSW 12 71022260 critical splice donor site probably null
R3411:Arid4a UTSW 12 71061525 splice site probably benign
R3768:Arid4a UTSW 12 71067119 missense probably damaging 1.00
R3838:Arid4a UTSW 12 71075785 missense possibly damaging 0.94
R4320:Arid4a UTSW 12 71069995 missense possibly damaging 0.69
R4589:Arid4a UTSW 12 71069964 missense probably damaging 1.00
R4829:Arid4a UTSW 12 71023498 critical splice acceptor site probably null
R4862:Arid4a UTSW 12 71075947 missense probably damaging 0.96
R4952:Arid4a UTSW 12 71023525 missense possibly damaging 0.64
R5072:Arid4a UTSW 12 71045079 missense probably benign 0.08
R5423:Arid4a UTSW 12 71069860 nonsense probably null
R5767:Arid4a UTSW 12 71060093 missense probably damaging 1.00
R5911:Arid4a UTSW 12 71069973 missense probably damaging 1.00
R5952:Arid4a UTSW 12 71063206 missense probably benign 0.10
R6088:Arid4a UTSW 12 71022236 missense probably damaging 0.99
R6235:Arid4a UTSW 12 71069772 intron probably null
R6277:Arid4a UTSW 12 71039891 missense possibly damaging 0.49
R6455:Arid4a UTSW 12 71075088 missense probably benign 0.04
R6523:Arid4a UTSW 12 71067341 splice site probably null
R6701:Arid4a UTSW 12 71087512 missense probably damaging 1.00
R6812:Arid4a UTSW 12 71047263 missense possibly damaging 0.92
R6815:Arid4a UTSW 12 71017082 splice site probably null
R6837:Arid4a UTSW 12 71075515 missense probably benign
R6858:Arid4a UTSW 12 71023509 missense probably benign 0.01
R6895:Arid4a UTSW 12 71063302 missense probably benign 0.18
R6901:Arid4a UTSW 12 71067137 missense probably damaging 0.99
R7387:Arid4a UTSW 12 71087496 missense probably damaging 1.00
R7570:Arid4a UTSW 12 71063142 nonsense probably null
R7772:Arid4a UTSW 12 71061589 missense possibly damaging 0.65
Z1176:Arid4a UTSW 12 71039920 missense possibly damaging 0.89
Z1177:Arid4a UTSW 12 71075637 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GCAATGTAAGTATACCGTTGCTT -3'
(R):5'- GCAGGAGGGGTACTGTTCAA -3'

Sequencing Primer
(F):5'- ATACCGTTGCTTTAGAAGTATGTG -3'
(R):5'- CTGCAATTAAAGGCCTGTGC -3'
Posted On2018-11-06