Incidental Mutation 'R6906:Gm8251'
ID538759
Institutional Source Beutler Lab
Gene Symbol Gm8251
Ensembl Gene ENSMUSG00000091844
Gene Namepredicted gene 8251
Synonyms
MMRRC Submission
Accession Numbers

Genbank: XM_985572; MGI: 3647616

Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R6906 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location44055952-44061936 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 44056013 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 1975 (S1975N)
Ref Sequence ENSEMBL: ENSMUSP00000127017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168641]
Predicted Effect probably benign
Transcript: ENSMUST00000168641
AA Change: S1975N

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000127017
Gene: ENSMUSG00000091844
AA Change: S1975N

DomainStartEndE-ValueType
Pfam:CCDC168_N 2 202 2.5e-83 PFAM
Pfam:CCDC168_N 200 302 1.7e-26 PFAM
Pfam:CCDC168_N 347 397 2.1e-4 PFAM
Pfam:CCDC168_N 437 581 8.5e-8 PFAM
Pfam:CCDC168_N 663 802 6.3e-5 PFAM
Pfam:CCDC168_N 788 955 1e-9 PFAM
low complexity region 1803 1819 N/A INTRINSIC
low complexity region 1830 1847 N/A INTRINSIC
low complexity region 1968 1984 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf2 A G 5: 24,568,842 F350L possibly damaging Het
Ahnak2 T A 12: 112,785,313 T305S probably benign Het
Anp32a A G 9: 62,377,569 probably benign Het
Aplf A G 6: 87,630,086 S449P possibly damaging Het
Arl6ip4 A G 5: 124,116,551 R36G possibly damaging Het
Ascc1 G A 10: 60,004,852 D12N probably benign Het
Bin1 C A 18: 32,421,925 H243Q probably benign Het
Ccdc7a C A 8: 128,935,681 V547L unknown Het
Cntnap5c T A 17: 58,395,307 N1207K probably benign Het
Coro7 C A 16: 4,633,304 R507L probably benign Het
Crtap T A 9: 114,381,632 K291N probably benign Het
Csmd3 T C 15: 47,847,173 T1569A probably benign Het
Dmrta1 A G 4: 89,691,966 T388A probably benign Het
Ehd3 T C 17: 73,830,338 F501L probably damaging Het
Fam126a A T 5: 23,999,958 W12R probably damaging Het
Fam160a2 G A 7: 105,388,269 T369I probably damaging Het
Fbn2 A C 18: 58,071,819 L1184R possibly damaging Het
Hsf1 T C 15: 76,477,719 probably null Het
Kansl1l T C 1: 66,723,278 H810R possibly damaging Het
Lrp5 A T 19: 3,622,638 I557N probably damaging Het
Lypd1 T C 1: 125,910,459 E41G probably damaging Het
Mgam A G 6: 40,747,919 Y443C probably damaging Het
Muc2 A G 7: 141,698,733 D871G probably damaging Het
Nup85 T A 11: 115,580,943 Y198N probably damaging Het
Obscn T A 11: 59,032,918 M6578L possibly damaging Het
Olfr1097 T C 2: 86,890,747 T143A probably benign Het
Osbpl5 G C 7: 143,694,328 Q667E probably damaging Het
Ovgp1 T A 3: 105,986,873 probably benign Het
Prl8a2 T A 13: 27,348,917 N37K probably benign Het
Ptprf A T 4: 118,269,277 I93N possibly damaging Het
Rnf112 T C 11: 61,450,389 S457G probably null Het
Sema3e A G 5: 14,240,587 D562G probably damaging Het
Sesn3 A G 9: 14,325,641 M472V probably damaging Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 127,021,626 probably benign Het
Shc3 T C 13: 51,466,559 T144A probably damaging Het
Sis A G 3: 72,919,485 L1287P probably damaging Het
Srrm2 C T 17: 23,820,363 P2090S probably damaging Het
Syne2 T G 12: 75,995,986 D3910E possibly damaging Het
Tcaim C T 9: 122,834,774 T443I probably benign Het
Tex19.1 T C 11: 121,147,122 V102A probably benign Het
Tpd52l1 T G 10: 31,332,954 T168P possibly damaging Het
Trdn G A 10: 33,233,948 C294Y probably benign Het
Trmt1l T C 1: 151,452,175 Y479H probably benign Het
Vmn1r171 G A 7: 23,632,379 V10I probably benign Het
Zbtb41 T A 1: 139,423,390 D80E possibly damaging Het
Zcchc4 A G 5: 52,823,634 K473E possibly damaging Het
Other mutations in Gm8251
AlleleSourceChrCoordTypePredicted EffectPPH Score
D3080:Gm8251 UTSW 1 44067335
R0045:Gm8251 UTSW 1 44057205 missense probably benign
R0110:Gm8251 UTSW 1 44059224 missense probably benign
R0450:Gm8251 UTSW 1 44061097 missense possibly damaging 0.85
R0469:Gm8251 UTSW 1 44061097 missense possibly damaging 0.85
R0510:Gm8251 UTSW 1 44061097 missense possibly damaging 0.85
R0602:Gm8251 UTSW 1 44059967 missense possibly damaging 0.96
R0648:Gm8251 UTSW 1 44056563 missense possibly damaging 0.73
R0928:Gm8251 UTSW 1 44057228 missense possibly damaging 0.73
R1056:Gm8251 UTSW 1 44060927 missense probably damaging 1.00
R1217:Gm8251 UTSW 1 44057179 missense possibly damaging 0.73
R1232:Gm8251 UTSW 1 44056592 missense possibly damaging 0.96
R1399:Gm8251 UTSW 1 44061311 missense possibly damaging 0.93
R1489:Gm8251 UTSW 1 44057790 missense probably benign 0.18
R1489:Gm8251 UTSW 1 44061507 missense probably benign 0.06
R1519:Gm8251 UTSW 1 44056970 missense probably benign 0.33
R1664:Gm8251 UTSW 1 44059227 missense possibly damaging 0.71
R1828:Gm8251 UTSW 1 44057074 missense possibly damaging 0.72
R1944:Gm8251 UTSW 1 44061849 missense probably damaging 0.97
R2032:Gm8251 UTSW 1 44061740 missense possibly damaging 0.86
R2094:Gm8251 UTSW 1 44059730 missense probably benign 0.06
R2170:Gm8251 UTSW 1 44056008 missense probably benign 0.18
R2185:Gm8251 UTSW 1 44061381 missense probably benign 0.01
R2280:Gm8251 UTSW 1 44056460 missense possibly damaging 0.53
R2281:Gm8251 UTSW 1 44056460 missense possibly damaging 0.53
R2339:Gm8251 UTSW 1 44060863 missense probably benign
R3617:Gm8251 UTSW 1 44060954 missense probably benign
R3738:Gm8251 UTSW 1 44058866 missense probably benign 0.33
R4012:Gm8251 UTSW 1 44060969 missense possibly damaging 0.85
R4034:Gm8251 UTSW 1 44058866 missense probably benign 0.33
R4344:Gm8251 UTSW 1 44060991 missense possibly damaging 0.86
R4436:Gm8251 UTSW 1 44056116 missense probably benign 0.03
R4485:Gm8251 UTSW 1 44060123 missense probably benign
R4735:Gm8251 UTSW 1 44061701 missense probably benign
R4782:Gm8251 UTSW 1 44059043 missense possibly damaging 0.85
R4837:Gm8251 UTSW 1 44061434 missense possibly damaging 0.93
R4862:Gm8251 UTSW 1 44058018 missense possibly damaging 0.93
R5247:Gm8251 UTSW 1 44057006 nonsense probably null
R5347:Gm8251 UTSW 1 44057795 missense probably benign 0.01
R5355:Gm8251 UTSW 1 44057979 missense possibly damaging 0.53
R5559:Gm8251 UTSW 1 44058515 missense possibly damaging 0.77
R5640:Gm8251 UTSW 1 44061927 missense probably benign 0.00
R5681:Gm8251 UTSW 1 44061464 missense possibly damaging 0.93
R5776:Gm8251 UTSW 1 44056505 missense possibly damaging 0.72
R5919:Gm8251 UTSW 1 44056986 missense probably benign
R5987:Gm8251 UTSW 1 44057257 missense probably benign
R6616:Gm8251 UTSW 1 44061474 missense possibly damaging 0.51
R6677:Gm8251 UTSW 1 44058699 missense probably benign 0.00
R6830:Gm8251 UTSW 1 44056730 missense probably benign 0.33
R6909:Gm8251 UTSW 1 44059775 missense possibly damaging 0.71
R6957:Gm8251 UTSW 1 44057207 missense probably benign 0.00
R7008:Gm8251 UTSW 1 44059625 missense probably benign
R7052:Gm8251 UTSW 1 44057306 missense possibly damaging 0.53
R7176:Gm8251 UTSW 1 44060346 missense probably benign 0.00
R7190:Gm8251 UTSW 1 44061615 missense probably benign 0.32
R7296:Gm8251 UTSW 1 44060916 nonsense probably null
R7347:Gm8251 UTSW 1 44059496 missense probably damaging 0.99
R7371:Gm8251 UTSW 1 44061377 missense probably benign
R7375:Gm8251 UTSW 1 44060534 missense possibly damaging 0.53
R7442:Gm8251 UTSW 1 44058708 missense possibly damaging 0.84
R7450:Gm8251 UTSW 1 44058773 missense probably benign 0.33
R7574:Gm8251 UTSW 1 44059433 missense possibly damaging 0.93
R7586:Gm8251 UTSW 1 44060013 missense probably benign 0.20
R7739:Gm8251 UTSW 1 44056418 missense possibly damaging 0.86
R7878:Gm8251 UTSW 1 44056014 missense probably benign 0.18
R7959:Gm8251 UTSW 1 44057568 missense probably benign
R7991:Gm8251 UTSW 1 44059709 missense probably benign 0.00
R8035:Gm8251 UTSW 1 44061551 missense possibly damaging 0.51
R8281:Gm8251 UTSW 1 44056538 missense possibly damaging 0.93
YA93:Gm8251 UTSW 1 44065085 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGAGTCTACCTTTACAGGAGCTG -3'
(R):5'- GCCAAATGCTCATTGGCAG -3'

Sequencing Primer
(F):5'- CTACCTTTACAGGAGCTGAGTTGAGC -3'
(R):5'- AATGCTCATTGGCAGAACATC -3'
Posted On2018-11-06