Incidental Mutation 'R6906:Abcf2'
ID538772
Institutional Source Beutler Lab
Gene Symbol Abcf2
Ensembl Gene ENSMUSG00000028953
Gene NameATP-binding cassette, sub-family F (GCN20), member 2
Synonyms0710005O05Rik, Drr3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.230) question?
Stock #R6906 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location24565345-24577467 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24568842 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 350 (F350L)
Ref Sequence ENSEMBL: ENSMUSP00000030795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030795]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030795
AA Change: F350L

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030795
Gene: ENSMUSG00000028953
AA Change: F350L

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
AAA 115 308 1.6e-6 SMART
AAA 427 595 6.32e-5 SMART
Meta Mutation Damage Score 0.4388 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ATP-binding cassette (ABC) transporter superfamily. ATP-binding casette proteins transport various molecules across extra- and intracellular membranes. Alterations in this gene may be involved in cancer progression. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 3 and 7. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak2 T A 12: 112,785,313 T305S probably benign Het
Anp32a A G 9: 62,377,569 probably benign Het
Aplf A G 6: 87,630,086 S449P possibly damaging Het
Arl6ip4 A G 5: 124,116,551 R36G possibly damaging Het
Ascc1 G A 10: 60,004,852 D12N probably benign Het
Bin1 C A 18: 32,421,925 H243Q probably benign Het
Ccdc7a C A 8: 128,935,681 V547L unknown Het
Cntnap5c T A 17: 58,395,307 N1207K probably benign Het
Coro7 C A 16: 4,633,304 R507L probably benign Het
Crtap T A 9: 114,381,632 K291N probably benign Het
Csmd3 T C 15: 47,847,173 T1569A probably benign Het
Dmrta1 A G 4: 89,691,966 T388A probably benign Het
Ehd3 T C 17: 73,830,338 F501L probably damaging Het
Fam126a A T 5: 23,999,958 W12R probably damaging Het
Fam160a2 G A 7: 105,388,269 T369I probably damaging Het
Fbn2 A C 18: 58,071,819 L1184R possibly damaging Het
Gm8251 C T 1: 44,056,013 S1975N probably benign Het
Hsf1 T C 15: 76,477,719 probably null Het
Kansl1l T C 1: 66,723,278 H810R possibly damaging Het
Lrp5 A T 19: 3,622,638 I557N probably damaging Het
Lypd1 T C 1: 125,910,459 E41G probably damaging Het
Mgam A G 6: 40,747,919 Y443C probably damaging Het
Muc2 A G 7: 141,698,733 D871G probably damaging Het
Nup85 T A 11: 115,580,943 Y198N probably damaging Het
Obscn T A 11: 59,032,918 M6578L possibly damaging Het
Olfr1097 T C 2: 86,890,747 T143A probably benign Het
Osbpl5 G C 7: 143,694,328 Q667E probably damaging Het
Ovgp1 T A 3: 105,986,873 probably benign Het
Prl8a2 T A 13: 27,348,917 N37K probably benign Het
Ptprf A T 4: 118,269,277 I93N possibly damaging Het
Rnf112 T C 11: 61,450,389 S457G probably null Het
Sema3e A G 5: 14,240,587 D562G probably damaging Het
Sesn3 A G 9: 14,325,641 M472V probably damaging Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 127,021,626 probably benign Het
Shc3 T C 13: 51,466,559 T144A probably damaging Het
Sis A G 3: 72,919,485 L1287P probably damaging Het
Srrm2 C T 17: 23,820,363 P2090S probably damaging Het
Syne2 T G 12: 75,995,986 D3910E possibly damaging Het
Tcaim C T 9: 122,834,774 T443I probably benign Het
Tex19.1 T C 11: 121,147,122 V102A probably benign Het
Tpd52l1 T G 10: 31,332,954 T168P possibly damaging Het
Trdn G A 10: 33,233,948 C294Y probably benign Het
Trmt1l T C 1: 151,452,175 Y479H probably benign Het
Vmn1r171 G A 7: 23,632,379 V10I probably benign Het
Zbtb41 T A 1: 139,423,390 D80E possibly damaging Het
Zcchc4 A G 5: 52,823,634 K473E possibly damaging Het
Other mutations in Abcf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Abcf2 APN 5 24568796 missense possibly damaging 0.95
IGL02867:Abcf2 APN 5 24571151 missense probably benign 0.03
IGL03325:Abcf2 APN 5 24574212 missense probably damaging 1.00
IGL03329:Abcf2 APN 5 24571248 critical splice acceptor site probably null
R0281:Abcf2 UTSW 5 24566564 missense probably damaging 1.00
R0357:Abcf2 UTSW 5 24573465 missense probably benign 0.16
R0815:Abcf2 UTSW 5 24567270 missense probably damaging 1.00
R0835:Abcf2 UTSW 5 24574253 missense probably damaging 0.99
R1793:Abcf2 UTSW 5 24568776 missense probably benign
R2321:Abcf2 UTSW 5 24567253 nonsense probably null
R5006:Abcf2 UTSW 5 24576537 nonsense probably null
R5765:Abcf2 UTSW 5 24573423 missense probably damaging 0.99
R6317:Abcf2 UTSW 5 24569158 nonsense probably null
R6684:Abcf2 UTSW 5 24569139 missense probably damaging 1.00
R6980:Abcf2 UTSW 5 24565972 missense probably benign 0.01
R8266:Abcf2 UTSW 5 24576591 small insertion probably benign
R8267:Abcf2 UTSW 5 24576591 small insertion probably benign
R8290:Abcf2 UTSW 5 24576591 small insertion probably benign
R8294:Abcf2 UTSW 5 24576591 small insertion probably benign
R8295:Abcf2 UTSW 5 24576591 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AGGAGGCACTTTCAGGTCAG -3'
(R):5'- AGGGAAATCACACTGCTCTTCTC -3'

Sequencing Primer
(F):5'- CAGGTCAGGGCTTTTTCTTAAAGTC -3'
(R):5'- TCTCCACCTGGATTGGGAC -3'
Posted On2018-11-06